G83465


Basic Information

Item Value
gene id G83465
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000013
NCBI id null
chromosome length 12551977
location 8078814 ~ 8079209 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU94927
TAATGATAAAGGAGTCCCTTTTAAATACAAGGAAGTTTTGTTACATTATAAAATCCCAGTCACAGCAAGGGAATATGCTATTGTTTCTGGAGCCATCCCTTCTGGGATTGTTATATTTATGAAGTGATTTAATAACCAGTTTTCTCAGATTGTGCCACTTCTTAATGTGTCTGAATAACATTTGTTGGTAAATCATCCCTTACCATAAAGTCAAATAACAGGAGTGTTCATGTTCTGCTCAAGCGTGAGGTTGTCTTTTGTCCTAATGTCATCTTTTATTGAAACGTATAGGTATGTAAACATGTAGGTAACATTAACTGGGATAGAGTGTGGGGCTTTGCCTCAGAAAATTTTTATGTACAATAAAATCAAAGAAGCATCTTATAAAATGATACG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU94927 True 396 lncRNA 0.34 1 8078814 8079209

Neighbor

gene id symbol gene type direction distance location
CI01000013_08072726_08076570 NA coding downstream 1623 8072579 ~ 8077191 (-)
CI01000013_08059677_08060143 COTL1 coding downstream 18671 8058968 ~ 8060143 (-)
CI01000013_08042921_08047883 TLDC1 coding downstream 30354 8042210 ~ 8048460 (-)
CI01000013_08016159_08020344 PLCG2 coding downstream 58470 8016115 ~ 8020344 (-)
CI01000013_07989784_08013498 NA coding downstream 64878 7989711 ~ 8013936 (-)
CI01000013_08080409_08086491 TAT coding upstream 1151 8080360 ~ 8087554 (-)
CI01000013_08090811_08094235 NA coding upstream 10464 8089673 ~ 8094304 (-)
CI01000013_08098898_08099508 UQCRFS1 coding upstream 19549 8098758 ~ 8099508 (-)
CI01000013_08229647_08258878 TBXAS1 coding upstream 149963 8229172 ~ 8258878 (-)
CI01000013_08308180_08308362 NA coding upstream 228642 8307851 ~ 8309913 (-)
G83471 NA non-coding downstream 94212 7982184 ~ 7984602 (-)
G83477 NA non-coding downstream 104385 7972740 ~ 7974429 (-)
G83475 NA non-coding downstream 120758 7956962 ~ 7958056 (-)
G83211 NA non-coding downstream 178646 7868770 ~ 7900168 (-)
G83395 NA non-coding downstream 256803 7821700 ~ 7822011 (-)
G83620 NA non-coding upstream 371630 8450839 ~ 8451904 (-)
G83658 NA non-coding upstream 405359 8484568 ~ 8484769 (-)
G83662 NA non-coding upstream 416834 8496043 ~ 8496249 (-)
G83663 NA non-coding upstream 417226 8496435 ~ 8496691 (-)
G83677 NA non-coding upstream 449943 8529152 ~ 8529368 (-)
CI01000013_07339918_07367774 NA other downstream 696454 7339709 ~ 7367774 (-)
CI01000013_05883498_05884071 CHTF8 other downstream 2194442 5882049 ~ 5884071 (-)
G81547 NA other downstream 2334776 5739526 ~ 5744038 (-)
G81032 NA other downstream 3328253 4748809 ~ 4750561 (-)
CI01000013_04561253_04567647 MAP2K1 other downstream 3519911 4560340 ~ 4567647 (-)
CI01000013_09309438_09335834 MICAL3A other upstream 1227827 9307036 ~ 9336077 (-)
G85170 NA other upstream 2400652 10479861 ~ 10480700 (-)
CI01000013_10564288_10569141 NA other upstream 2484250 10563459 ~ 10569290 (-)
G85188 NA other upstream 2512995 10592204 ~ 10595337 (-)
G85401 NA other upstream 2955823 11035032 ~ 11035466 (-)

Expression


Co-expression Network