G83692


Basic Information

Item Value
gene id G83692
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000013
NCBI id null
chromosome length 12551977
location 8661601 ~ 8661813 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU95178
CTGTAATAGACATGAGCTGCAAAAGTATTCTCGAATCAATAAAAGTTTTTTGTTAAAGTGTTTTGAATTGATCTCACTATAGTGTTCATTGGGCAGGAAAGTAGTCTGTGTATTTGTTAGATTTGTGTGTCATGACTCATGAGGCCAAAGTTTGATTCTGACAAAAAAGAATCTTTTTGACTGAACTATTTGATTTTGACTTGACAGTTTGGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU95178 True 213 lncRNA 0.33 1 8661601 8661813

Neighbor

gene id symbol gene type direction distance location
CI01000013_08616374_08648611 BICD1A, BICD1 coding downstream 12990 8616204 ~ 8648611 (-)
CI01000013_08555865_08573521 FGD4, FGD4A coding downstream 88080 8555208 ~ 8573521 (-)
CI01000013_08418098_08441411 NA coding downstream 219850 8417837 ~ 8441751 (-)
CI01000013_08311120_08328130 NA coding downstream 333258 8310985 ~ 8328343 (-)
CI01000013_08308180_08308362 NA coding downstream 351688 8307851 ~ 8309913 (-)
CI01000013_08732651_08797549 TMTC2 coding upstream 70838 8732651 ~ 8797549 (-)
CI01000013_08950324_08962808 NA coding upstream 288165 8949978 ~ 8962808 (-)
CI01000013_09007324_09008538 NA coding upstream 345444 9007257 ~ 9008749 (-)
CI01000013_09293519_09305846 TTC38 coding upstream 631320 9293133 ~ 9305846 (-)
CI01000013_09309438_09335834 MICAL3A coding upstream 647559 9307036 ~ 9336077 (-)
G83634 NA non-coding downstream 108358 8551722 ~ 8553243 (-)
G83631 NA non-coding downstream 111752 8545354 ~ 8549849 (-)
G83636 NA non-coding downstream 119683 8539931 ~ 8541918 (-)
G83633 NA non-coding downstream 125576 8531160 ~ 8536025 (-)
G83695 NA non-coding upstream 3792 8665605 ~ 8665808 (-)
G83699 NA non-coding upstream 7182 8668995 ~ 8669251 (-)
G83702 NA non-coding upstream 16078 8677891 ~ 8678105 (-)
G83706 NA non-coding upstream 23073 8684886 ~ 8685095 (-)
G83707 NA non-coding upstream 26014 8687827 ~ 8688071 (-)
CI01000013_07339918_07367774 NA other downstream 1279241 7339709 ~ 7367774 (-)
CI01000013_05883498_05884071 CHTF8 other downstream 2777229 5882049 ~ 5884071 (-)
G81547 NA other downstream 2917563 5739526 ~ 5744038 (-)
G81032 NA other downstream 3911040 4748809 ~ 4750561 (-)
CI01000013_04561253_04567647 MAP2K1 other downstream 4102698 4560340 ~ 4567647 (-)
G85170 NA other upstream 1818048 10479861 ~ 10480700 (-)
CI01000013_10564288_10569141 NA other upstream 1901646 10563459 ~ 10569290 (-)
G85188 NA other upstream 1930391 10592204 ~ 10595337 (-)
G85401 NA other upstream 2373219 11035032 ~ 11035466 (-)

Expression


Co-expression Network