G83707


Basic Information

Item Value
gene id G83707
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000013
NCBI id null
chromosome length 12551977
location 8687827 ~ 8688071 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU95193
GTCGTTCCACACCTGTGAGACCTTCGTTCATCTTCGGAACACAAATTAAGATATTTTTGATAAAATCTGATGGCTCAATGAGGCCTAATTAAGGCCTATCTAGTGATGGGCGATTTCAAAACGAATCTTTTGTTTCGAATCAGTGGTTCGGAGCACGTATCAAACTGCCAAAGTCACGTGATTTCAGTAAACGAGGCTTCATTACGTCATAAGTGTTTCGAAATTTCAATGGTTCACCACTGGGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU95193 True 245 lncRNA 0.41 1 8687827 8688071

Neighbor

gene id symbol gene type direction distance location
CI01000013_08616374_08648611 BICD1A, BICD1 coding downstream 39216 8616204 ~ 8648611 (-)
CI01000013_08555865_08573521 FGD4, FGD4A coding downstream 114306 8555208 ~ 8573521 (-)
CI01000013_08418098_08441411 NA coding downstream 246076 8417837 ~ 8441751 (-)
CI01000013_08311120_08328130 NA coding downstream 359484 8310985 ~ 8328343 (-)
CI01000013_08308180_08308362 NA coding downstream 377914 8307851 ~ 8309913 (-)
CI01000013_08732651_08797549 TMTC2 coding upstream 44580 8732651 ~ 8797549 (-)
CI01000013_08950324_08962808 NA coding upstream 261907 8949978 ~ 8962808 (-)
CI01000013_09007324_09008538 NA coding upstream 319186 9007257 ~ 9008749 (-)
CI01000013_09293519_09305846 TTC38 coding upstream 605062 9293133 ~ 9305846 (-)
CI01000013_09309438_09335834 MICAL3A coding upstream 621301 9307036 ~ 9336077 (-)
G83706 NA non-coding downstream 2732 8684886 ~ 8685095 (-)
G83702 NA non-coding downstream 9722 8677891 ~ 8678105 (-)
G83699 NA non-coding downstream 18576 8668995 ~ 8669251 (-)
G83695 NA non-coding downstream 22019 8665605 ~ 8665808 (-)
G83692 NA non-coding downstream 26014 8661601 ~ 8661813 (-)
G83724 NA non-coding upstream 25133 8713204 ~ 8713469 (-)
G83725 NA non-coding upstream 26110 8714181 ~ 8714464 (-)
G83641 NA non-coding upstream 29152 8717223 ~ 8819314 (-)
G83640 NA non-coding upstream 77621 8765692 ~ 8782735 (-)
G83767 NA non-coding upstream 203225 8891296 ~ 8891501 (-)
CI01000013_07339918_07367774 NA other downstream 1305467 7339709 ~ 7367774 (-)
CI01000013_05883498_05884071 CHTF8 other downstream 2803455 5882049 ~ 5884071 (-)
G81547 NA other downstream 2943789 5739526 ~ 5744038 (-)
G81032 NA other downstream 3937266 4748809 ~ 4750561 (-)
CI01000013_04561253_04567647 MAP2K1 other downstream 4128924 4560340 ~ 4567647 (-)
G85170 NA other upstream 1791790 10479861 ~ 10480700 (-)
CI01000013_10564288_10569141 NA other upstream 1875388 10563459 ~ 10569290 (-)
G85188 NA other upstream 1904133 10592204 ~ 10595337 (-)
G85401 NA other upstream 2346961 11035032 ~ 11035466 (-)

Expression


Co-expression Network