G82453


Basic Information

Item Value
gene id G82453
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000013
NCBI id null
chromosome length 12551977
location 8700616 ~ 8700839 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU93832
CTGAAATCTCAAAAACTGCTTGGCAAACTCACAATTAAATAACATATTTCAAATCAGCAACAAAATCTGACATGAACTGTCCCATAAATGTTGGTTATTATGCTCAAATAGCCTAAAAAAAAGCTTATTTTTCAGCCTAGACTAGCCAATGCGCGTGTACAGTCCTAAGCTCGAGTCTCAGGTTTCTATGGGAACCGGAGTTTCTAATGGCAGCTGCAGTGACG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU93832 True 224 lncRNA 0.39 1 8700616 8700839

Neighbor

gene id symbol gene type direction distance location
CI01000013_08652173_08660558 NA coding upstream 39545 8652173 ~ 8661156 (+)
CI01000013_08530191_08551478 NUP205 coding upstream 148995 8529349 ~ 8551621 (+)
CI01000013_08519555_08527531 FAM107B coding upstream 172905 8519110 ~ 8527711 (+)
CI01000013_08485928_08493559 NA coding upstream 206993 8485401 ~ 8493623 (+)
CI01000013_08448494_08481411 NA coding upstream 217705 8447275 ~ 8482911 (+)
CI01000013_08925040_08937556 CRACR2A coding downstream 223722 8924561 ~ 8938923 (+)
CI01000013_08943859_08944315 NA coding downstream 241999 8942838 ~ 8944625 (+)
CI01000013_09075883_09113011 NA coding downstream 374986 9075825 ~ 9113283 (+)
CI01000013_09178561_09180465 NA coding downstream 476268 9177107 ~ 9195268 (+)
CI01000013_09243644_09260619 TSPAN9A, TSPAN9B, TSPAN9, TSN9 coding downstream 542805 9243644 ~ 9260619 (+)
G82155 NA non-coding upstream 395214 8252713 ~ 8305402 (+)
G82162 NA non-coding upstream 470488 8228727 ~ 8230128 (+)
G82178 NA non-coding upstream 613600 8083578 ~ 8087016 (+)
G82184 NA non-coding upstream 623314 8074660 ~ 8077302 (+)
G82503 NA non-coding downstream 133233 8834072 ~ 8846060 (+)
G82526 NA non-coding downstream 209558 8910397 ~ 8910626 (+)
G82557 NA non-coding downstream 281384 8982223 ~ 8982501 (+)
G82612 NA non-coding downstream 364294 9065133 ~ 9074576 (+)
G82168 NA other upstream 659273 8028338 ~ 8041343 (+)
G81994 NA other upstream 1362377 7335945 ~ 7338239 (+)
CI01000013_06076169_06080164 NA other upstream 2618249 6075400 ~ 6081684 (+)
CI01000013_06050285_06059640 NA other upstream 2641120 6049864 ~ 6060269 (+)
G80845 NA other upstream 3864384 4835078 ~ 4836232 (+)
G82581 NA other downstream 628490 9329329 ~ 9334948 (+)
G84005 NA other downstream 900772 9601611 ~ 9602235 (+)
G84194 NA other downstream 1329769 10030608 ~ 10036953 (+)
G84215 NA other downstream 1375615 10076454 ~ 10079336 (+)
G84250 NA other downstream 1514288 10215127 ~ 10215962 (+)

Expression


Co-expression Network