G307130 (cog1,LOC107601277,LOC107721521)


Basic Information

Item Value
gene id G307130
gene name cog1,LOC107601277,LOC107721521
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NW_019172846.1
NCBI id APWO02000057.1
chromosome length 1249306
location 793384 ~ 794830 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU422922
CTGGCTGCTGGCCAGGGGAAGGATGTTGTATGGTTCCTGAGAGCCGATGCTGCTGCTTCTGGGAGTAAACTGCTTTTCTGTGCCGGTTAAAAGACCTAAGAGCACTGAGGTTCTCTGAGTTAGCCGGTTCAGGTTGCTGTTAAGATGAGGGGTGAACACGTCCAGATCAAACGGGTCAATATGGCTCTCCAAGGAGTCACAGATCTCCTGAACCCTGGGGTCCTGCTGCGATCGAGAGCTCTTCCCCTCCTCCAGCCGAGAGCCCAGAGTGGCTGAGAGGAAGCGCAGGTCAAACAGGAGCTGCAGAGCTCTGTTCTGAG

Function

symbol description
cog1 Predicted to act upstream of or within intra-Golgi vesicle-mediated transport and protein transport. Predicted to be located in membrane. Predicted to be part of Golgi transport complex. Predicted to be active in Golgi apparatus. Human ortholog(s) of this gene implicated in congenital disorder of glycosylation type IIg. Orthologous to human COG1 (component of oligomeric golgi complex 1).

NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU422922 True 320 lncRNA 0.55 3 793384 794830

Neighbor

gene id symbol gene type direction distance location
LOC103025515 si:dkeyp-72e1.9,LOC108438022,LOC107721498,LOC107601283,LOC107688120 coding downstream 122679 556386 ~ 670705 (-)
pdxdc1 pdxdc1,LOC107601286 coding downstream 308482 452594 ~ 484902 (-)
LOC103041204 gspt1l,LOC108438004,LOC107721494,LOC100304847,LOC107654506,LOC107590378 coding downstream 344724 432157 ~ 448660 (-)
pirt pirt,LOC103042629 coding downstream 366364 424326 ~ 427020 (-)
nde1 nde1,LOC107654507,LOC107688124,LOC107601288 coding downstream 376002 392198 ~ 417382 (-)
rgs9 LOC108438013,LOC108278703 coding upstream 9819 804649 ~ 828631 (-)
LOC103045885 slc16a6,LOC108438015 coding upstream 106131 900961 ~ 911850 (-)
wipi1 wipi1,LOC107590389,LOC105899989,LOC107719990,LOC107688112 coding upstream 133222 928052 ~ 947398 (-)
LOC103021341 zgc:86896,LOC108436955,LOC108259475,LOC105899990,LOC107601274,LOC107590453,LOC104927173 coding upstream 154839 949669 ~ 965473 (-)
dus1l dus1l,LOC107654489,LOC107601270,LOC107688109,LOC107590391 coding upstream 234262 1029092 ~ 1043561 (-)
G307100 glyr1,LOC107590383,LOC107688117,LOC107721499 non-coding downstream 39004 714416 ~ 754380 (-)
G307097 ppl,LOC107601282,LOC107688119 non-coding downstream 61513 687873 ~ 731871 (-)
G307041 NA non-coding downstream 237126 555377 ~ 556258 (-)
G307005 LOC103040592,LOC108438007,LOC107721468,LOC108274424 non-coding downstream 265909 501883 ~ 527475 (-)
G307001 NA non-coding downstream 284443 494538 ~ 508941 (-)
G307132 NA non-coding upstream 88392 883222 ~ 894718 (-)
G307144 NA non-coding upstream 122266 917096 ~ 922717 (-)
G307150 prkar1a,prkar1aa,LOC107721504,LOC107654492,LOC108274040,LOC107590390 non-coding upstream 175327 970157 ~ 1044317 (-)
G307190 csnk1d,LOC106596082,LOC102211647,LOC103154369,LOC103024472,LOC108259482,LOC107720075,LOC107590392,LOC107601268,LOC105899999,LOC107654491 non-coding upstream 269227 1064057 ~ 1078972 (-)
G307200 engase non-coding upstream 307244 1102074 ~ 1106222 (-)
smim22 smim22,si:ch1073-443f11.2,LOC107688153 other downstream 17169 771120 ~ 776215 (-)
LOC111191304 NA other downstream 642133 83699 ~ 151251 (-)

Expression


Co-expression Network