G84403


Basic Information

Item Value
gene id G84403
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000013
NCBI id null
chromosome length 12551977
location 10610973 ~ 10611229 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU96050
GTAAAATTCATTTTTTGAATATCTCCGAATTTACATACGCCACTCTTTGGTGTAGGCTATCTTGAGCGATTTTGAAGTCTATATAGTACTATATAGTCATATAGTACCTGACAGACATAGGTGTCTTAGAATCTGACAGCTAAGAAGACCGATTTGTAAACAAATAGTTATTTTAGGTTGAATCTTTTTAAAGACTCGGTTAAACCGAGACCGATCTGAGCAACGCGTTCACGAATCGGGCTGGATATCCGAACGGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU96050 True 257 lncRNA 0.38 1 10610973 10611229

Neighbor

gene id symbol gene type direction distance location
CI01000013_10586449_10594082 NA coding upstream 16531 10585818 ~ 10594442 (+)
CI01000013_10502138_10525511 GRM3 coding upstream 85299 10500690 ~ 10525674 (+)
CI01000013_10335904_10336688 NA coding upstream 274077 10335904 ~ 10336896 (+)
CI01000013_10261599_10283287 NA coding upstream 327006 10260271 ~ 10283967 (+)
CI01000013_09681047_09683275 LRRC4, LRRC4.2 coding upstream 927540 9681047 ~ 9683433 (+)
CI01000013_10756927_10790192 FRMD4A coding downstream 145698 10756927 ~ 10792761 (+)
CI01000013_10808688_10819703 NA coding downstream 197459 10808688 ~ 10819925 (+)
CI01000013_10821530_10827412 SEPHS1, SEPHS1.L coding downstream 210301 10821530 ~ 10827977 (+)
CI01000013_10865753_10884937 MAPK8IP2 coding downstream 254524 10865753 ~ 10886301 (+)
CI01000013_10916049_11031034 NA coding downstream 302466 10913695 ~ 11031159 (+)
G84389 NA non-coding upstream 7043 10603574 ~ 10603930 (+)
G84396 NA non-coding upstream 37669 10573093 ~ 10573304 (+)
G84379 NA non-coding upstream 53486 10557271 ~ 10557487 (+)
G84378 NA non-coding upstream 54052 10556712 ~ 10556921 (+)
G84377 NA non-coding upstream 54490 10556177 ~ 10556483 (+)
G84404 NA non-coding downstream 965 10612194 ~ 10612415 (+)
G84405 NA non-coding downstream 2922 10614151 ~ 10614377 (+)
G84390 NA non-coding downstream 22166 10633395 ~ 10643805 (+)
G84386 NA non-coding downstream 33217 10644446 ~ 10657577 (+)
G84250 NA other upstream 395011 10215127 ~ 10215962 (+)
G84215 NA other upstream 531637 10076454 ~ 10079336 (+)
G84194 NA other upstream 574180 10030608 ~ 10036953 (+)
G84005 NA other upstream 1008738 9601611 ~ 9602235 (+)
G82581 NA other upstream 1276025 9329329 ~ 9334948 (+)
G84768 NA other downstream 1558760 12169989 ~ 12170818 (+)
G84790 NA other downstream 1573713 12184942 ~ 12201975 (+)
G84864 NA other downstream 1753820 12365049 ~ 12375905 (+)

Expression


Co-expression Network