G49119


Basic Information

Item Value
gene id G49119
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035902.1
NCBI id CM008305.1
chromosome length 52532229
location 2398482 ~ 2398829 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU66403
tgatggtttttctgtacatgcacacacactcttaccccacttaccccagaaaatggaaagcactaaaaaccctactacctcactggactctattgcacactgtgtaatagagtaattactacctcacctggtcttttttgcacactgcataatttgcacactgtcttgttatttatttttctttgtctgtattgtgttgtattgtctgtctgcacttttgtactgttgcactattgttctgtctacactgtgtttatgtgcaccatggtccctggaggaacgttgtttcgtttcactgtgtactctgtatatagctgaaatgacaataaaaaccactttgactttgac

Function

GO:

id name namespace
GO:0010035 response to inorganic substance biological_process
GO:0010038 response to metal ion biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU66403 True 348 lncRNA 0.39 1 2398482 2398829

Neighbor

gene id symbol gene type direction distance location
LOC103028158 cebpb,LOC103028158,LOC107556312,LOC107669676,LOC107751442,LOC108265421 coding upstream 36258 2359922 ~ 2362224 (+)
LOC103045867 mc3r,LOC103045867,LOC108425022,LOC107751459,LOC107711834,LOC107680356,LOC107669608 coding upstream 397312 1999574 ~ 2001170 (+)
LOC103027674 LOC108425035 coding upstream 612120 1772919 ~ 1786362 (+)
pym1 pym1,LOC102777374 coding upstream 634407 1760812 ~ 1764075 (+)
LOC103041629 sema3b,LOC107717529,LOC107556489,LOC107669651 coding upstream 936784 1415274 ~ 1461698 (+)
adipor1 adipor1,adipor1b,LOC108425077,LOC107751445,LOC107679819 coding downstream 66764 2465593 ~ 2474573 (+)
klhl12 klhl12 coding downstream 79762 2478591 ~ 2506196 (+)
LOC103031418 tuba8l,LOC106567204,LOC105022333,LOC106572477,LOC103031418,LOC108265838,LOC108425079,LOC107711852,LOC107679810,LOC107594520 coding downstream 111315 2510144 ~ 2521419 (+)
LOC103026437 LOC108425081 coding downstream 128640 2527469 ~ 2583319 (+)
LOC103035089 NA coding downstream 185716 2584545 ~ 2597636 (+)
G49118 NA non-coding upstream 7901 2390362 ~ 2390581 (+)
G49114 NA non-coding upstream 13847 2384426 ~ 2384635 (+)
G49112 NA non-coding upstream 55973 2340205 ~ 2342509 (+)
G49109 NA non-coding upstream 80797 2315391 ~ 2317685 (+)
G49102 NA non-coding upstream 83334 2268337 ~ 2315148 (+)
G49120 NA non-coding downstream 3854 2402683 ~ 2402977 (+)
G49121 NA non-coding downstream 5686 2404515 ~ 2404728 (+)
G49122 NA non-coding downstream 26301 2425130 ~ 2427911 (+)
G49117 NA non-coding downstream 29291 2428120 ~ 2429643 (+)
G49116 NA non-coding downstream 33970 2432799 ~ 2479371 (+)
G48714 NA other upstream 1587217 808155 ~ 811265 (+)
faf1 faf1,LOC107743872 other downstream 584017 2982846 ~ 3152050 (+)
spata6 dnttip2,LOC107700367,LOC107603264,LOC107757995,LOC102796155 other downstream 1801110 4199939 ~ 4239873 (+)
G49475 NA other downstream 1845699 4244528 ~ 4246227 (+)
prok1 prok1,LOC107680267,LOC107711938,LOC107731240 other downstream 3220330 5619159 ~ 5627452 (+)
LOC103023397 NA other downstream 3378223 5777052 ~ 5789265 (+)

Expression


Co-expression Network