G49586


Basic Information

Item Value
gene id G49586
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035902.1
NCBI id CM008305.1
chromosome length 52532229
location 4404029 ~ 4453720 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU67047
tttgctctgattactgctttgcacactcttggcatcattctctatatgagcttcaagaggtggccacctgaaatgaaaagttttccaacagtcttgaatgaaggagttcccagaggtgtttattagcacttgttgcccctttgtcttcttcactctgtgctccagctcaccccaaaccatctggattgggttcaggtccggtgactgtggaggttcagctcattttttattgttaagtacataaaacttcacatgtgttcattcatagttttgatgc

Function

GO:

id name namespace
GO:0050877 nervous system process biological_process
GO:0007600 sensory perception biological_process
GO:0007606 sensory perception of chemical stimulus biological_process
GO:0007608 sensory perception of smell biological_process
GO:0003008 system process biological_process

KEGG:

id description
ko04740 Olfactory transduction

RNA

RNA id representative length rna type GC content exon number start site end site
TU67047 True 277 lncRNA 0.43 2 4404029 4453720

Neighbor

gene id symbol gene type direction distance location
agbl4 agbl4,LOC107603279 coding upstream 209315 3519608 ~ 4194714 (+)
bend5 bend5,LOC106584333,LOC107707580 coding upstream 362327 4020453 ~ 4041702 (+)
dmrta2 dmrta2,LOC107578325 coding upstream 1228270 3172009 ~ 3175759 (+)
rnf11 rnf11,rnf11b coding upstream 1486598 2881685 ~ 2917431 (+)
ttc39a ttc39a,LOC107743871,LOC107599797,LOC107657886,LOC107752432 coding upstream 1527601 2828935 ~ 2876428 (+)
pdpn NA coding downstream 435988 4889708 ~ 4909202 (+)
LOC103034196 NA coding downstream 476824 4930544 ~ 4943083 (+)
LOC103035057 rimkla,LOC107556480,LOC107717536,LOC107669631,LOC107711947,LOC107591767 coding downstream 500557 4954277 ~ 4993901 (+)
nfya nfya,nfyal,LOC108265435,LOC107731273,LOC107668092 coding downstream 747310 5201030 ~ 5210826 (+)
ahcyl1 ahcyl1,LOC107679038,LOC107591817,LOC107668032,LOC107731197 coding downstream 759684 5213404 ~ 5258615 (+)
LOC111192750 NA non-coding upstream 38450 4330195 ~ 4365579 (+)
G49571 mrpl55 non-coding upstream 106462 4294830 ~ 4297567 (+)
G49460 NA non-coding upstream 185695 4113712 ~ 4218334 (+)
G49399 NA non-coding upstream 348268 4042778 ~ 4055761 (+)
G49397 NA non-coding upstream 351154 3966593 ~ 4052875 (+)
G49589 NA non-coding downstream 17799 4471519 ~ 4525653 (+)
G49587 fnbp1l,LOC107757999,LOC107599010 non-coding downstream 72438 4526158 ~ 4632053 (+)
G49606 NA non-coding downstream 184817 4638537 ~ 4641062 (+)
G49615 abl2 non-coding downstream 201034 4654754 ~ 4658061 (+)
G49613 NA non-coding downstream 271636 4725356 ~ 4755688 (+)
G49475 NA other upstream 157802 4244528 ~ 4246227 (+)
spata6 dnttip2,LOC107700367,LOC107603264,LOC107757995,LOC102796155 other upstream 164156 4199939 ~ 4239873 (+)
faf1 faf1,LOC107743872 other upstream 1251979 2982846 ~ 3152050 (+)
G48714 NA other upstream 3592764 808155 ~ 811265 (+)
prok1 prok1,LOC107680267,LOC107711938,LOC107731240 other downstream 1165439 5619159 ~ 5627452 (+)
LOC103023397 NA other downstream 1323332 5777052 ~ 5789265 (+)
G50063 NA other downstream 1917800 6371520 ~ 6376705 (+)
LOC103039117 nol4la,LOC103039117,LOC108412512,LOC108265968,LOC107680239,LOC107550513,LOC107731219,LOC107745834,LOC107549982 other downstream 2409636 6863356 ~ 6941978 (+)
trnae-cuc NA other downstream 2530470 6984190 ~ 6984261 (+)

Expression


Co-expression Network