G51912 (fzr1,fzr1a,LOC105895242)


Basic Information

Item Value
gene id G51912
gene name fzr1,fzr1a,LOC105895242
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035902.1
NCBI id CM008305.1
chromosome length 52532229
location 13340424 ~ 13343218 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU70020
TCCGGAGGCGAGCAGCTGATGGTCGGTGCTCCATTTGAGGCCGCACACCTCCTGTCGGTGGCCCTGCAGCCTGCGCTCTGACTGCAGCGGCGGCGTCCGAATGTCCCTCTGCAGGATCATACGATCCCGGCTACCTGAGGACAGCTGGTCGGCGTTCCACGCTAACGCACCAACTCTGGCTGTGTGCCCCTCTAATGCAAATAGCTTCTTGCCAGCTGCCGCGTCCCAGATCTGTACAAATCCTTTATGTGTCCCCACAGCCACGTGATTCCCCCTTTCTGACCAGCCAACCGACGTCACAGAGTCTCCCTCTACTGACAGGTCACACAGACGGGTTACTTGGCTTGTGCAGGCACTCCACAGGTAGACACAGGTCCCCAGCCCAACACTGAGCACGTTTAAGGACGACCAGTCAACCAGGTTGAGGTAGAAATCATCTTGCAGTTCTGGAGCGTCCAGGACTTTAAACGGGATCTTGGAGATTTTGCGTGTGGGCTTCCTTGGTGAGCGGAGCAACTTTTG

Function

symbol description
fzr1a Predicted to enable anaphase-promoting complex binding activity and ubiquitin ligase activator activity. Predicted to be involved in anaphase-promoting complex-dependent catabolic process and positive regulation of anaphase-promoting complex-dependent catabolic process. Predicted to act upstream of or within cell division and positive regulation of ubiquitin protein ligase activity. Predicted to be part of anaphase-promoting complex. Orthologous to human FZR1 (fizzy and cell division cycle 20 related 1).
fzr1 Predicted to enable anaphase-promoting complex binding activity and ubiquitin ligase activator activity. Involved in anaphase-promoting complex-dependent catabolic process; mitotic G2 DNA damage checkpoint signaling; and positive regulation of protein metabolic process. Located in nuclear membrane and nucleoplasm. Colocalizes with anaphase-promoting complex.

NR:

description
fizzy-related protein homolog

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU70020 True 522 lncRNA 0.57 4 13340424 13343218

Neighbor

gene id symbol gene type direction distance location
dohh dohh,LOC107745802,LOC107548993,LOC106584359 coding downstream 7413 13326667 ~ 13333011 (-)
LOC103040738 adamts10,LOC107676806,LOC107731268,LOC107585873,LOC106613844 coding downstream 494978 12765442 ~ 12845446 (-)
LOC103044727 myo1f,LOC108413823,LOC108264988,LOC107750961,LOC108238367 coding downstream 594344 12698781 ~ 12746080 (-)
acer1 acer1,LOC107585930,LOC107731201,LOC107676796 coding downstream 645559 12679475 ~ 12694865 (-)
LOC103045339 mllt1a,mllt1 coding downstream 663525 12652988 ~ 12676899 (-)
haus5 haus5 coding upstream 4021 13347239 ~ 13368318 (-)
wdr13 wdr13,LOC107584863,LOC106572373,LOC107552201 coding upstream 26679 13369897 ~ 13390106 (-)
LOC103033264 NA coding upstream 102168 13445386 ~ 13457273 (-)
LOC103033893 NA coding upstream 117246 13460464 ~ 13467261 (-)
LOC103033588 tnni3k,LOC107550356,LOC107743849,LOC107657874,LOC107699804,LOC107710912 coding upstream 156246 13499464 ~ 13526880 (-)
G51840 NA non-coding downstream 17994 13312031 ~ 13322430 (-)
LOC111192612 NA non-coding downstream 245590 13078332 ~ 13094834 (-)
LOC111192613 NA non-coding downstream 265084 13045536 ~ 13075340 (-)
G51867 NA non-coding downstream 383250 12955977 ~ 12957174 (-)
G51843 NA non-coding downstream 408365 12851593 ~ 12932059 (-)
G51916 NA non-coding upstream 19430 13362648 ~ 13364675 (-)
G51919 NA non-coding upstream 21598 13364816 ~ 13366835 (-)
G51842 NA non-coding upstream 24207 13367425 ~ 13402243 (-)
G51932 NA non-coding upstream 90683 13433901 ~ 13434545 (-)
G51941 NA non-coding upstream 144701 13487919 ~ 13490199 (-)
smim24 NA other downstream 16741 13285303 ~ 13323683 (-)
LOC103042573 cunh1orf21,zgc:92140,LOC107676598,LOC107585858,LOC107750760,LOC107700167 other downstream 1458483 11831802 ~ 11881941 (-)
G51346 NA other downstream 2136001 11204054 ~ 11204423 (-)
G51187 kansl3,LOC107678435 other downstream 3023957 10313482 ~ 10316467 (-)
LOC103023850 NA other downstream 3042976 10294056 ~ 10297448 (-)
LOC111192615 ssbp3b,LOC108439398,LOC108265320,LOC107585824,LOC107699856,LOC107710925,LOC107657912 other upstream 222780 13565998 ~ 13592947 (-)
G51960 glis1 other upstream 320183 13663401 ~ 13664114 (-)
G52161 NA other upstream 1065718 14408936 ~ 14411611 (-)
G52299 NA other upstream 1733078 15076296 ~ 15084568 (-)
LOC103028883 LOC108430093 other upstream 2818422 16161640 ~ 16219847 (-)

Expression


Co-expression Network