G55332


Basic Information

Item Value
gene id G55332
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035902.1
NCBI id CM008305.1
chromosome length 52532229
location 29451088 ~ 29451356 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU74600
aggagagttgagctgcacattgaattctgtcgtgatttgggcagccgtggttttatgttttttggatacaatccgggttagcacccgaacatccctttcagacagcttcctcttacagcatccacagttaatcctgttggatgtggttggtccttcttggtggtatgctgacattaccctggataccgtggctcttgatgcatcacaaagacttgctgtcttggtcacagatgctccagcaagacgtgcacccacaatttgtcctcttt

Function

GO:

id name namespace
GO:0010942 positive regulation of cell death biological_process
GO:0043065 positive regulation of apoptotic process biological_process
GO:0043068 positive regulation of programmed cell death biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU74600 True 269 lncRNA 0.48 1 29451088 29451356

Neighbor

gene id symbol gene type direction distance location
LOC103024952 LOC108412520 coding downstream 62534 29220555 ~ 29388554 (-)
lzts1 lzts1 coding downstream 495865 28901548 ~ 28955223 (-)
LOC111192730 NA coding downstream 566201 28881879 ~ 28884887 (-)
msi1 msi1,LOC107687968 coding downstream 592928 28827738 ~ 28858160 (-)
tmem233 LOC107687986 coding downstream 637177 28806678 ~ 28813911 (-)
LOC111192660 NA coding upstream 199072 29650428 ~ 29652090 (-)
LOC103024435 NA coding upstream 219011 29670367 ~ 29702656 (-)
LOC103023912 LOC108410873 coding upstream 280082 29731438 ~ 29738545 (-)
LOC103023281 NA coding upstream 297490 29748846 ~ 29756606 (-)
LOC103022657 LOC108410872 coding upstream 405385 29856741 ~ 29895050 (-)
G55320 NA non-coding downstream 282806 29167967 ~ 29168282 (-)
G55317 NA non-coding downstream 419763 29031087 ~ 29031325 (-)
G55315 NA non-coding downstream 463760 28986770 ~ 28987328 (-)
G55299 NA non-coding downstream 555550 28892275 ~ 28895538 (-)
G55281 NA non-coding downstream 578099 28872698 ~ 28872989 (-)
G55336 NA non-coding upstream 73297 29524653 ~ 29525127 (-)
G55387 NA non-coding upstream 194688 29646044 ~ 29727767 (-)
G55433 NA non-coding upstream 392079 29843435 ~ 29844402 (-)
LOC111192661 NA non-coding upstream 393526 29844882 ~ 29853518 (-)
G55434 NA non-coding upstream 395350 29846706 ~ 29847108 (-)
LOC103031600 lrrc75ba,LOC108414797,LOC107753104,LOC107712478,LOC105891565 other downstream 850578 28554727 ~ 28600510 (-)
LOC111192657 NA other downstream 1027133 28417733 ~ 28423955 (-)
G55023 cunh5orf51,clg13h5orf51,LOC103038767,LOC107667559,LOC107686395,LOC106585203 other downstream 1293639 28153421 ~ 28157449 (-)
LOC103039900 NA other downstream 1407837 28026739 ~ 28043251 (-)
G54947 NA other downstream 1720009 27728711 ~ 27731079 (-)
kiaa1671 NA other upstream 292672 29744028 ~ 29840753 (-)
LOC103046862 LOC108410878 other upstream 445159 29896515 ~ 29934430 (-)
LOC103027498 LOC108411246,LOC106585447 other upstream 2184125 31635481 ~ 31690808 (-)
LOC103043418 arpc5la,arpc5l,LOC108411248,LOC107571143,LOC108265305,LOC107550963,LOC107753090,LOC107676626 other upstream 2280108 31731464 ~ 31740221 (-)
LOC103021360 LOC108440818,LOC107659619,LOC108265551,LOC107726210,LOC107553829,LOC107684495 other upstream 3320671 32772027 ~ 32802160 (-)

Expression


Co-expression Network