G58145


Basic Information

Item Value
gene id G58145
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035902.1
NCBI id CM008305.1
chromosome length 52532229
location 41852589 ~ 41944829 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU78389
ggataatacagctctctacagttcatctttcagcccaagcagctaacagcagcagtttagagcagccgtcacgcagtcactgctcggattacattataaacaggtcagttagcgcgctgctaacctcatgatgtttataactacggagtttagtggacacaccacggctgcaaggttagactgttgaaggctactgaagactactaaagcaggcaacgcagcgtaagcaaaaaaaaacaaaaaccacacacacacaccaaaatacaagttaagataaaatatgaaaacgaacataataaagcataaataattaaattgaattgcgggccagatgtatgtttattttgttaacccgtgaggggccgtatgaaaccgcgtgggccggtactttgagacccctggtgtaatagtgttgagggaaggtataatattgttaagggaaggtgtaatgttaaaggtgtaatagtgttgagggaaggtgtaatgtaaa

Function

GO:

id name namespace
GO:0010035 response to inorganic substance biological_process
GO:0010038 response to metal ion biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU78389 True 490 lncRNA 0.42 3 41852589 41944829

Neighbor

gene id symbol gene type direction distance location
pex10 pex10 coding downstream 324699 41516965 ~ 41527890 (-)
LOC103034037 NA coding downstream 339502 41493604 ~ 41513087 (-)
LOC103033502 NA coding downstream 358918 41457996 ~ 41493671 (-)
clcn6 clcn6 coding downstream 416111 41405371 ~ 41436478 (-)
plod1 plod1,plod1a,LOC107698842 coding downstream 555896 41281161 ~ 41296693 (-)
LOC103035734 NA coding upstream 34728 41979557 ~ 42034244 (-)
LOC103037059 gpr153,LOC107687122,LOC107693426 coding upstream 142559 42087388 ~ 42177716 (-)
acot7 acot7,LOC107754737 coding upstream 263887 42208716 ~ 42389129 (-)
LOC103037387 LOC108432136 coding upstream 445917 42390746 ~ 42392957 (-)
LOC103027912 NA coding upstream 464150 42408979 ~ 42411388 (-)
G58031 mthfr,LOC107687111 non-coding downstream 399607 41449213 ~ 41452982 (-)
G57920 NA non-coding downstream 1090417 40761495 ~ 40762172 (-)
G57925 wrap73,LOC107678416,LOC107748967,LOC107710786,LOC107595759 non-coding downstream 1104050 40741514 ~ 40748539 (-)
G57916 NA non-coding downstream 1187825 40664520 ~ 40664764 (-)
G57788 NA non-coding downstream 1561403 40290977 ~ 40291186 (-)
G58185 NA non-coding upstream 107121 42051950 ~ 42052535 (-)
G58184 NA non-coding upstream 108048 42052877 ~ 42053889 (-)
G58191 NA non-coding upstream 137438 42082267 ~ 42082568 (-)
G58208 NA non-coding upstream 168361 42113190 ~ 42113620 (-)
G58236 NA non-coding upstream 379006 42323835 ~ 42324250 (-)
G58022 LOC103032860,LOC108432146 other downstream 454111 41396086 ~ 41398478 (-)
tprg1l tprg1l,LOC107710788,LOC107678419,LOC107698845,LOC106513028 other downstream 1096575 40748741 ~ 40756014 (-)
LOC103037008 LOC108442081,LOC105022382,LOC106567250 other downstream 1673448 40165400 ~ 40179141 (-)
G57727 kdm5c,LOC107550909,LOC107747206,LOC107570512 other downstream 1733494 40117789 ~ 40119095 (-)
LOC103030299 fkbp1aa,fkb1b,fkbp1a,LOC103030299,LOC107553142,LOC107574256,LOC107752559,LOC107707744 other downstream 2289668 39521544 ~ 39562921 (-)
G58435 aaas other upstream 1158041 43102870 ~ 43107623 (-)
G58537 NA other upstream 1737495 43682324 ~ 43682684 (-)
G58649 NA other upstream 2423071 44367900 ~ 44368368 (-)
G58678 NA other upstream 2529330 44474159 ~ 44477666 (-)
snrnp200 snrnp200,LOC107686403,LOC107602857,LOC107667532,LOC107600001,LOC108265067 other upstream 2641477 44586306 ~ 44622074 (-)

Expression


Co-expression Network