G59793 (apeh,LOC105013991)



Basic Information


Item Value
gene id G59793
gene name apeh,LOC105013991
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information


Item Value
chromosome id NC_035902.1
NCBI id CM008305.1
chromosome length 52532229
location 48922590 ~ 48925434 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence


>TU80602
TGCCGACGTTTCCAGGCAGGGAGAGGATGCTGTCCTGACCGTAGCCGATAGATCCTCTGTAATTAACTTGTAAGACACCAAAACCCATTCTGCAGAGGACTGCTTCTGAAAGGAACCACTCTGCCACGAACACTGAATGAGGTCCACCATGTGGAGTGACAATAAGAGGTAGTTTTGTTCCCTCCTTCACTCCCTTTGGTTTCAGCAATATGGCATCAAAGTCCAGA

Function


symbol description
apeh Predicted to enable serine-type endopeptidase activity. Predicted to act upstream of or within proteolysis. Is expressed in pronephric duct and pronephric mesoderm. Orthologous to human APEH (acylaminoacyl-peptide hydrolase).

NR:

description
PREDICTED: acylamino-acid-releasing enzyme isoform X1

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU80602 True 227 lncRNA 0.48 3 48922590 48925434

Neighbor


gene id symbol gene type direction distance location
cacna2d3 cacna2d3 coding upstream 504378 47998093 ~ 48418212 (+)
LOC103038409 LOC103038409,LOC108411948,LOC107724878,LOC107667523,LOC107689282,LOC107711839,LOC107602832,LOC107600045 coding upstream 988979 47927955 ~ 47933611 (+)
il17rb NA coding upstream 1028635 47880396 ~ 47893955 (+)
cacna1d cacna1d coding upstream 1066058 47711376 ~ 47856532 (+)
LOC103044878 NA coding upstream 1250293 47664880 ~ 47672297 (+)
cep350 NA coding downstream 277834 49203268 ~ 49268872 (+)
LOC103029228 NA coding downstream 347560 49272994 ~ 49308775 (+)
LOC103028608 xpr1a,xpr1,LOC107755298,LOC107758009,LOC107699288,LOC107665065,LOC107603171 coding downstream 544998 49470432 ~ 49539741 (+)
sin3b sin3b,LOC106613916 coding downstream 623210 49548644 ~ 49568835 (+)
LOC103028292 def6,def6a,LOC107550223,LOC107757990,LOC107755289,LOC107700524,LOC107599059 coding downstream 645278 49570712 ~ 49600806 (+)
G59788 NA non-coding upstream 14563 48907715 ~ 48908027 (+)
G59772 NA non-coding upstream 402308 48519069 ~ 48520282 (+)
G59735 NA non-coding upstream 443827 48478320 ~ 48478763 (+)
G59734 NA non-coding upstream 444480 48477837 ~ 48478110 (+)
G59733 NA non-coding upstream 488387 48433973 ~ 48434203 (+)
G59798 NA non-coding downstream 3024 48928458 ~ 48928806 (+)
G59853 NA non-coding downstream 107403 49032837 ~ 49035805 (+)
G59855 NA non-coding downstream 111179 49036613 ~ 49037045 (+)
G59883 NA non-coding downstream 313793 49239227 ~ 49271983 (+)
G59970 NA non-coding downstream 527088 49452522 ~ 49453328 (+)
G59782 NA other upstream 42967 48870167 ~ 48879623 (+)
gnb1 gnb1,gnb1a,LOC103044197,LOC104956353,LOC107666091,LOC107595416,LOC107385217 other upstream 1261233 47623554 ~ 47661357 (+)
G59257 cdk11a,LOC108265382 other upstream 2040699 46852364 ~ 46881891 (+)
G58971 NA other upstream 3132436 45789711 ~ 45790154 (+)
LOC103029434 dgcr6,LOC103029434,LOC108430318,LOC107572069,LOC107721026,LOC108265986,LOC105899531 other upstream 4055752 44852780 ~ 44866838 (+)
G59806 NA other downstream 72726 48998160 ~ 48998471 (+)
lhx4 lhx4,LOC108412864,LOC107665078,LOC107755297,LOC107599001,LOC107699337,LOC107550233,LOC107758007 other downstream 396844 49322278 ~ 49370251 (+)
G59961 NA other downstream 498082 49423516 ~ 49437613 (+)
LOC103025235 LOC103025235,LOC108413084,LOC108265140,LOC107598993,LOC107665077,LOC107755310,LOC107603028 other downstream 942184 49867618 ~ 49990417 (+)
LOC103045694 NA other downstream 1714060 50639494 ~ 50652906 (+)

Expression



Co-expression Network