CI01000016_02719966_02722011 (MRPS15, PL8L1)


Basic Information

Item Value
gene id CI01000016_02719966_02722011
gene name MRPS15, PL8L1
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 2719966 ~ 2722191 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000016_02719966_02722011.mRNA
GAGTTTTGGATCAGCAGCTGATGAAGACCTGTCATATGAAAGACTGATGCATTGTGGTTGTGCGGCTAGTGCAAATGGTTTGGCTGCTCTCAGTTCCTTGAACTTGATAATTTTACAAGAAATGCATGATGCATCAGACATGTCAAACCCAGTCATCACTCAGCCTGGTGCCGGCTCTTATGGTACAAATGTGCAGACTGGAGAATGGAGCACTGGTCTTTGTTCTTGCTGCAGTGACCTACTTGTCTGTGCTCTTGGCTGTATCTGTCCACTAGCTCTCAGCTGTTACACAGCAAACAAGTATGGTGAGAATGTATGTCTCGCGTGTGTACCTGGAGGAATGGCTGCAATGAGGACACACATGCGACTGACCTATGGAATACAGGGCACAATATGCAATGATGCTTTGATGGCCTGTTGCTGTGGACTATTTGAAACATGTCGAATGGCCAGAGAAATCCGTATCAGGAATGGAGAGACTTAGACTCCTTTACTGTTTCAGTTTTAAAATTTTTTATATTTTTGAAAGCATTCAAATTCAACAAAATCAACATTAATTCATTAATTAATCAATAATCATACCTTAAGTCCAAATCGCCTAAGTATAATATATGGCAGGAGAATTAAATCCATGATAGAATCCGTAAACATACATTCTTTGGAA

Function

symbol description
mrps15 Predicted to be a structural constituent of ribosome. Predicted to act upstream of or within translation. Predicted to be located in mitochondrion and ribosome. Predicted to be part of mitochondrial small ribosomal subunit. Orthologous to human MRPS15 (mitochondrial ribosomal protein S15).

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000016_02719966_02722011.mRNA True 664 mRNA 0.41 4 2719966 2722191

Neighbor

gene id symbol gene type direction distance location
CI01000016_02714495_02719654 NA coding upstream 220 2714412 ~ 2719746 (+)
CI01000016_02662862_02676190 CAPN7, CAN7 coding upstream 43668 2661658 ~ 2676298 (+)
CI01000016_02576551_02588698 PIK3R4 coding upstream 130846 2576551 ~ 2589120 (+)
CI01000016_02559364_02565395 CALB1 coding upstream 153860 2559364 ~ 2566106 (+)
CI01000016_02528921_02540450 NA coding upstream 179314 2528146 ~ 2540652 (+)
CI01000016_02722831_02730864 OSCP1B, OSCP1 coding downstream 640 2722831 ~ 2731578 (+)
CI01000016_02741163_02753993 STK40 coding downstream 18972 2741163 ~ 2754053 (+)
CI01000016_02793868_02796984 EVA1BA coding downstream 71677 2793868 ~ 2797333 (+)
CI01000016_02876373_02882129 NA coding downstream 153996 2876187 ~ 2882148 (+)
CI01000016_02918064_02918435 NA coding downstream 195573 2917764 ~ 2918540 (+)
G94898 NA non-coding upstream 27955 2691683 ~ 2692011 (+)
G94874 NA non-coding upstream 174961 2544751 ~ 2545005 (+)
G94850 NA non-coding upstream 211075 2508643 ~ 2508891 (+)
G94848 NA non-coding upstream 216524 2503127 ~ 2503442 (+)
G94729 NA non-coding upstream 361858 2357488 ~ 2358108 (+)
G94901 NA non-coding downstream 11557 2733748 ~ 2734245 (+)
G94904 NA non-coding downstream 90152 2812343 ~ 2812551 (+)
G94905 NA non-coding downstream 93898 2816089 ~ 2816299 (+)
G94858 NA non-coding downstream 95196 2817387 ~ 2822216 (+)
G94906 NA non-coding downstream 108549 2830740 ~ 2832069 (+)
G93406 NA other upstream 1792434 905400 ~ 927532 (+)
G95439 NA other downstream 1139984 3862175 ~ 3862305 (+)
G95648 NA other downstream 1550445 4272636 ~ 4273905 (+)
CI01000016_04829592_04837305 NA other downstream 2112367 4829592 ~ 4837457 (+)
G95792 NA other downstream 2497689 5219880 ~ 5225941 (+)
CI01000016_05405791_05407797 AICDA other downstream 2683678 5405791 ~ 5407963 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_010879 mrps15 coding NC_007127.7 CM002900.2 36095582 ~ 36118514 (-)
grasscarp (Ctenopharyngodon idella) G109239 NA non-coding CI01000019 null 5321266 ~ 5322123 (+)
striped catfish (Pangasianodon hypophthalmus) G8017 pl8l1,LOC107588526,LOC107755659,LOC107704880,LOC107705924,LOC107700712,LOC106583166 non-coding NC_047595.1 CM018541.1 14542787 ~ 14544801 (+)
tiger barb (Puntius tetrazona) G83824 NA non-coding NC_056709.1 CM032078.1 21911336 ~ 21911542 (+)