CI01000016_05930860_05934507 (RCVRN2)


Basic Information

Item Value
gene id CI01000016_05930860_05934507
gene name RCVRN2
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 5930853 ~ 5934507 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000016_05930860_05934507.mRNA
ATGGGGAATGCCAAAAGCAGTGCTATGTCCAAGGAGATCCTGGAGGATCTCAAACTCAATACCAAATTCACAGAGGATGAACTGGCACAGTGGTACGAGAACTTCAAGAAGCAGTGCCCGTCCGGCCGTATCACACCAGAAGAGTTTAAAAAGATCTACGAACGCTTTTTCCCAGAAAGTGACGCCACATCATACGCCCAACACGTCTTCCGCTCCTTTGACACGAACGATGATGGAACATTGGATTTCAAGGAATACATTATCGCTCTACATATGACATCAACTGGAAAGACGGAGCGGAAGCTGGAGTGGGCCTTTTCACTCTTCGATGTTGACAAGAACGGATACATCACCAAGGCAGAAGTGACAGAAATCTGCCAGGCTATCTTTAAGCTGATCCCCAAAGAGGACCAAGAGAATCTTCCAGCAGACGAGAACACTCCTGAGAAGAGAGCAGACAAACTGTGGTCGTACTTCGATAAAAAAGAAAATGAACGACTGGCTGAGGGTGAGTTTATTCAAGGTGTTCTTGAAAACGAAGACGCTATCCACCTTATTCAGTATGAGCCCAAAAAGTAACAATAAA

Function

symbol description
rcvrn2 Predicted to enable calcium ion binding activity. Acts upstream of or within cone photoresponse recovery. Is expressed in epiphysis; retina; retinal outer nuclear layer; and retinal photoreceptor layer. Orthologous to human RCVRN (recoverin).

NR:

description
Zgc:73075

GO:

id name namespace
GO:0036368 cone photoresponse recovery biological_process

KEGG:

id description
K13764 RCVRN; recoverin

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000016_05930860_05934507.mRNA True 586 mRNA 0.45 3 5930853 5934507

Neighbor

gene id symbol gene type direction distance location
CI01000016_05910340_05911197 NA coding downstream 18681 5910252 ~ 5912172 (-)
CI01000016_05871353_05874812 NA coding downstream 56041 5871184 ~ 5874812 (-)
CI01000016_05843077_05863364 TTYH1 coding downstream 67489 5842120 ~ 5863364 (-)
CI01000016_05824628_05826424 UBE2S coding downstream 104429 5823123 ~ 5826424 (-)
CI01000016_05804456_05811231 SHISA7 coding downstream 119622 5803128 ~ 5811231 (-)
CI01000016_05945614_05946695 NA coding upstream 11052 5945559 ~ 5948309 (-)
CI01000016_05986400_05994821 TRIM109 coding upstream 51893 5986400 ~ 5994821 (-)
CI01000016_06018338_06023791 NA coding upstream 83823 6018330 ~ 6023791 (-)
CI01000016_06048748_06054049 RNF115 coding upstream 114233 6048740 ~ 6054049 (-)
CI01000016_06069691_06109173 ITGA10 coding upstream 134783 6069290 ~ 6109173 (-)
G97188 NA non-coding downstream 7474 5887681 ~ 5923379 (-)
G97191 NA non-coding downstream 22549 5894654 ~ 5908304 (-)
G97185 NA non-coding downstream 43756 5881377 ~ 5887097 (-)
G97255 NA non-coding downstream 95942 5834570 ~ 5834911 (-)
G97252 NA non-coding downstream 153185 5777404 ~ 5777668 (-)
G97282 NA non-coding upstream 18451 5952958 ~ 5959473 (-)
G97193 NA non-coding upstream 25834 5960341 ~ 5964341 (-)
G97201 NA non-coding upstream 49562 5984069 ~ 5984824 (-)
G97303 NA non-coding upstream 145767 6080274 ~ 6080496 (-)
G97310 NA non-coding upstream 160373 6094880 ~ 6095235 (-)
CI01000016_05412782_05415867 NA other downstream 512636 5412248 ~ 5415906 (-)
CI01000016_05325805_05330265 COX6B2 other downstream 600007 5325519 ~ 5332874 (-)
CI01000016_04921091_04922518 NA other downstream 1007449 4918975 ~ 4922518 (-)
CI01000016_03921124_03930996 NA other downstream 1999802 3920055 ~ 3931162 (-)
CI01000016_03647744_03675574 NA other downstream 2265540 3647653 ~ 3675585 (-)
G97341 NA other upstream 224479 6158986 ~ 6159721 (-)
CI01000016_08893013_08893496 NPPCL, ANFC1 other upstream 2954326 8888833 ~ 8894737 (-)
CI01000016_08926089_08945071 NA other upstream 3002282 8925960 ~ 8945229 (-)
G98679 NA other upstream 3300489 9234996 ~ 9239929 (-)
G98691 NA other upstream 3321595 9256102 ~ 9257611 (-)

Expression


Co-expression Network