CI01000016_08748359_08750572


Basic Information

Item Value
gene id CI01000016_08748359_08750572
gene name NA
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 8748359 ~ 8750736 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000016_08748359_08750572.mRNA
CGGTCATCATGAAAAGAACATGGGCTTTGTTCAAATCCCATCCATACCTCTCCAACGTGGTGGGATACACAACGCTGTTCGCCACAGCAGACCTCATTCAGCAAAGCATGCTGGGAAAAGCTCAGGACAAAGTGACAGAACACAAACTGGATCGAATGCGACAAGATCCATCCAAGATATCCACTGAAGGATTTACTGTGGCTGGAGAAGCAAAGACAGATGATCTGACTTTGTATGATACCAAAATAATTTACTCAGAAGGCAACAAAAAAGCCTCAGAAGAAAATAAAACATTAGCTCCAGTACAACATGTTTCACAGCTTCACAGCATTGACTGGGCCCAGACTGCTCGGACTGGATTGGTGTACTGGTCAACAATGCAGGCTGTGAACTTCTCCCTGATCCCGCCAGTGGCTCGTACTGTTTTTGTTGGAGGAGTAGCTCTTGGCTGGACTGTCTTCTTGTGTCATTTCAAGCAACAGAAAAATGACTTCCTGAGCTAGGCTATACAGCTGCTTGGCATTGAACTTAACAAAAAAATCAAAATATGCAACATGCATATATGCAACTTTGTACATATAATGGATGCATTAAAGCTGGCTGATGTTTCAAACAACTGAGATTTGAACAAATCATTTTTCATGTCTCCTATTGGGGTAAAGCACAA

Function

NR:

description
unnamed protein product

GO:

id name namespace
GO:0016021 integral component of membrane cellular_component

KEGG:

id description
K13349 MPV17L; Mpv17-like protein

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000016_08748359_08750572.mRNA True 667 mRNA 0.43 3 8748359 8750736

Neighbor

gene id symbol gene type direction distance location
CI01000016_08696516_08734418 MYH14 coding upstream 13699 8696516 ~ 8734660 (+)
CI01000016_08675783_08684401 KCNJ14 coding upstream 63853 8673411 ~ 8684506 (+)
CI01000016_08628196_08630801 NA coding upstream 116981 8628196 ~ 8631378 (+)
CI01000016_08553934_08565167 DFNA5 coding upstream 183113 8552843 ~ 8565246 (+)
CI01000016_08513514_08545976 OSBPL3B, OSBPL3 coding upstream 202222 8513514 ~ 8546137 (+)
CI01000016_08752386_08753821 RPL18.L, RPL18.S, RPL18 coding downstream 1650 8752386 ~ 8753821 (+)
CI01000016_08766170_08768621 LAG3 coding downstream 15434 8766170 ~ 8768778 (+)
CI01000016_08817749_08824067 NA coding downstream 67013 8817749 ~ 8824078 (+)
CI01000016_08916022_08916606 NA coding downstream 164292 8915028 ~ 8916667 (+)
CI01000016_09026732_09050431 NA coding downstream 275996 9026732 ~ 9050838 (+)
G98307 NA non-coding upstream 59140 8671758 ~ 8689219 (+)
G98294 NA non-coding upstream 92226 8655762 ~ 8656133 (+)
G98231 NA non-coding upstream 105381 8642761 ~ 8642978 (+)
G98230 NA non-coding upstream 105949 8642188 ~ 8642410 (+)
G98106 NA non-coding upstream 113929 8632923 ~ 8634430 (+)
G98315 NA non-coding downstream 11977 8762713 ~ 8762969 (+)
G98320 NA non-coding downstream 27807 8778543 ~ 8778763 (+)
G98321 NA non-coding downstream 29831 8780567 ~ 8780906 (+)
G98256 NA non-coding downstream 32877 8783613 ~ 8800681 (+)
G98317 NA non-coding downstream 64900 8815636 ~ 8816240 (+)
G97824 NA other upstream 732584 8014363 ~ 8015775 (+)
CI01000016_07784248_07784757 TWIST1, TWIST1.L, TWIST1A, TWIST1B, TWST2, TWIST1.S other upstream 962636 7783987 ~ 7784996 (+)
G96389 NA other upstream 1587069 7160641 ~ 7161290 (+)
CI01000016_05405791_05407797 AICDA other upstream 3340496 5405791 ~ 5407963 (+)
G95792 NA other upstream 3522418 5219880 ~ 5225941 (+)
G98288 NA other downstream 245362 8996098 ~ 9002717 (+)
CI01000016_09796196_09842235 NA other downstream 1044895 9795950 ~ 9842576 (+)
G99041 NA other downstream 1173682 9924418 ~ 9925654 (+)
G99410 NA other downstream 1483664 10234400 ~ 10236851 (+)
G99456 NA other downstream 1543655 10294391 ~ 10298904 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location