CI01000016_08871984_08874796 (OPN9)


Basic Information

Item Value
gene id CI01000016_08871984_08874796
gene name OPN9
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 8871984 ~ 8874796 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000016_08871984_08874796.mRNA
TCTGTCCCATGCATGGATTTTTGGGGAAACAGGATGTATCTGGTATGGGATGCAGGGCTTTGTTTTTGGTATTGGGTCTCTCATCACCACCTGCCTTATCTCCCTCGACCGCTGCTTCAAGATCTGTAGCGTTCGATATGGTCAGTGGATTGAAAGAAAACATGCCTCTCTGTCTGTTGCTCTGGTGTGGATCTATACATTGTTCTGGGCTTTACTTCCTTTGTTTGGGTTTGGTAGTTATGGCCCGGAACCGTTTGGAACCAGCTGCACCATAAACTGGTGGAGGATGAAGTCGTCACTCAATGATAGAGTCTATATTTTCCTGATCCTGTTACTCTGCTTTGGAGTTCCCACCCTCACTATCATCGCTTCATACCTTGCTATTATCATCAGGGTGTATTGGTCTGGTCGTATATTGGCTTCAATCCCTTCATCCAATGTTACTCACAGCAGCAAAGATCTTCGGCTGACAAAG

Function

symbol description
opn9 Predicted to enable G protein-coupled photoreceptor activity. Predicted to be involved in G protein-coupled receptor signaling pathway; cellular response to light stimulus; and phototransduction. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be integral component of plasma membrane. Is expressed in several structures, including gill; heart; integument; nervous system; and testis.

NR:

description
unnamed protein product, partial

GO:

id name namespace
GO:0004930 G protein-coupled receptor activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000016_08871984_08874796.mRNA True 475 mRNA 0.46 4 8871984 8874796

Neighbor

gene id symbol gene type direction distance location
CI01000016_08851218_08869647 IFFO1B coding downstream 2337 8850872 ~ 8869647 (-)
CI01000016_08833925_08836497 NA coding downstream 35487 8833490 ~ 8836497 (-)
CI01000016_08800360_08805384 NA coding downstream 66600 8798407 ~ 8805384 (-)
CI01000016_08769141_08795202 NA coding downstream 76425 8768822 ~ 8795559 (-)
CI01000016_08741387_08746007 NA coding downstream 125918 8740982 ~ 8746066 (-)
CI01000016_08881761_08888177 GAPDH coding upstream 6755 8881551 ~ 8888237 (-)
CI01000016_08893013_08893496 NPPCL, ANFC1 coding upstream 17802 8888833 ~ 8894737 (-)
CI01000016_08906943_08914821 NOP2 coding upstream 31816 8906612 ~ 8914940 (-)
CI01000016_08920718_08923668 EMG1 coding upstream 45669 8920465 ~ 8924048 (-)
CI01000016_08926089_08945071 NA coding upstream 51164 8925960 ~ 8945229 (-)
G98715 NA non-coding downstream 468 8871275 ~ 8871516 (-)
G98709 NA non-coding downstream 55095 8816414 ~ 8816889 (-)
G98708 NA non-coding downstream 56283 8814845 ~ 8815701 (-)
G98714 NA non-coding downstream 60752 8810429 ~ 8811232 (-)
G98713 NA non-coding downstream 62992 8808550 ~ 8808992 (-)
G98672 NA non-coding upstream 41126 8915922 ~ 8916673 (-)
G98658 NA non-coding upstream 49714 8924510 ~ 8925768 (-)
G98694 NA non-coding upstream 183016 9057812 ~ 9058118 (-)
G98776 NA non-coding upstream 226805 9101601 ~ 9101813 (-)
G98778 NA non-coding upstream 228427 9103223 ~ 9103458 (-)
G97341 NA other downstream 2712263 6158986 ~ 6159721 (-)
CI01000016_05412782_05415867 NA other downstream 3453767 5412248 ~ 5415906 (-)
CI01000016_05325805_05330265 COX6B2 other downstream 3541138 5325519 ~ 5332874 (-)
CI01000016_04921091_04922518 NA other downstream 3948580 4918975 ~ 4922518 (-)
CI01000016_03921124_03930996 NA other downstream 4940933 3920055 ~ 3931162 (-)
G98679 NA other upstream 360200 9234996 ~ 9239929 (-)
G98691 NA other upstream 381306 9256102 ~ 9257611 (-)
CI01000016_09510177_09512196 ID4 other upstream 634826 9509622 ~ 9512428 (-)

Expression


Co-expression Network