CI01000016_10587199_10588775 (CNOT10, CNOT10.L)


Basic Information

Item Value
gene id CI01000016_10587199_10588775
gene name CNOT10, CNOT10.L
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 10587199 ~ 10588775 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000016_10587199_10588775.mRNA
GTGCTCAATTCTAGCCTGCAGTGCATATGTGGCTCTTGCTCTTGGGGACAACTTAATGGCTCTTAACCACGCAGAAAAGCTCTTGCATCAGACAAAGCTGTCAGGATCGCTCAAGTTCCTGGGTCACCTATATGCTGCTGAAGCCCTGATCTCTCTGGACAGAATCTCTGATGCCATTGCACATCTCAACCCAGAGAATGTTACTGACGTCTCGTTAGGCGTGTCATCCAGCGAACAAGACCAAGGTTCTGATAAAGGAGATCTGGAGCCTGTGGAGTCCT

Function

symbol description
cnot10 Predicted to be involved in mRNA catabolic process and negative regulation of translation. Predicted to act upstream of or within gene silencing by RNA and regulation of translation. Predicted to be located in cytoplasm and nucleus. Predicted to be part of CCR4-NOT complex. Orthologous to human CNOT10 (CCR4-NOT transcription complex subunit 10).

GO:

id name namespace
GO:0005737 cytoplasm cellular_component

KEGG:

id description
K12607 CNOT10; CCR4-NOT transcription complex subunit 10

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000016_10587199_10588775.mRNA True 281 mRNA 0.49 3 10587199 10588775

Neighbor

gene id symbol gene type direction distance location
CI01000016_10508464_10510408 NA coding upstream 76367 10508464 ~ 10510832 (+)
CI01000016_10421936_10422623 NA coding upstream 162683 10420575 ~ 10424516 (+)
CI01000016_10339126_10370881 TRAK1 coding upstream 214548 10335258 ~ 10372651 (+)
CI01000016_10333877_10334229 NA coding upstream 252853 10333877 ~ 10334346 (+)
CI01000016_10042324_10051398 CTNNB1.L, CTNNB1 coding upstream 534832 10042016 ~ 10052367 (+)
CI01000016_10676271_10682495 NA coding downstream 87312 10676087 ~ 10682839 (+)
CI01000016_10748252_10749230 NA coding downstream 159477 10748252 ~ 10749343 (+)
CI01000016_10756608_10758149 NA coding downstream 165618 10754393 ~ 10758201 (+)
CI01000016_10760640_10783664 ANO10A, ANO10 coding downstream 171865 10760640 ~ 10783859 (+)
CI01000016_10865834_10867561 POMGNT2 coding downstream 276574 10865349 ~ 10867648 (+)
G99365 NA non-coding upstream 14643 10570702 ~ 10572556 (+)
G99362 NA non-coding upstream 64633 10516474 ~ 10522566 (+)
G99484 NA non-coding upstream 112456 10473981 ~ 10474743 (+)
G99461 NA non-coding upstream 200548 10385838 ~ 10386651 (+)
G99455 NA non-coding upstream 287587 10299359 ~ 10299612 (+)
G99379 NA non-coding downstream 5260 10594035 ~ 10594264 (+)
G99498 NA non-coding downstream 16193 10604968 ~ 10606304 (+)
G99364 NA non-coding downstream 40688 10629463 ~ 10632125 (+)
G99554 NA non-coding downstream 147421 10736196 ~ 10736496 (+)
G99552 NA non-coding downstream 147812 10736587 ~ 10736879 (+)
G99456 NA other upstream 288295 10294391 ~ 10298904 (+)
G99410 NA other upstream 350348 10234400 ~ 10236851 (+)
G99041 NA other upstream 661545 9924418 ~ 9925654 (+)
CI01000016_09796196_09842235 NA other upstream 790259 9795950 ~ 9842576 (+)
G98288 NA other upstream 1584482 8996098 ~ 9002717 (+)
G99940 NA other downstream 1082870 11671645 ~ 11672873 (+)
G100178 NA other downstream 1571866 12160641 ~ 12162845 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_009687 cnot10 coding NC_007127.7 CM002900.2 7703534 ~ 7730836 (+)