G93355


Basic Information

Item Value
gene id G93355
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 749343 ~ 749558 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU106225
CGATAGGGGTGATGGTCTTTGAGGAATCATGGGGGAGAAAGCAAGAATTCAGTCTCTTGCGTATTTCCTGGCTTTGGCTAACGTAGACCCACATGTACTGTACATTCCACGGCGCAAGTCAGACGTGAGAGCCTGGTGTTGGCGGCTCGACACCCCCAATTACACACCCTCACGCTGCAATCACATCCTCCCTGTGTGCGCTTAAGCATATCACAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU106225 True 216 lncRNA 0.52 1 749343 749558

Neighbor

gene id symbol gene type direction distance location
CI01000016_00569502_00581271 NA coding upstream 167844 569502 ~ 581499 (+)
CI01000016_00540871_00541608 PLEKHF2.L, PLEKHF2 coding upstream 207620 540632 ~ 541723 (+)
CI01000016_00496095_00506965 NDUFAF6 coding upstream 242310 496095 ~ 507033 (+)
CI01000016_00318676_00446341 NA coding upstream 303002 318676 ~ 446341 (+)
CI01000016_00294886_00298452 NA coding upstream 450182 294886 ~ 299161 (+)
CI01000016_00772375_00772848 NA coding downstream 22712 772270 ~ 772889 (+)
CI01000016_00885996_00887374 NA coding downstream 136438 885996 ~ 887478 (+)
CI01000016_00952494_00954683 NA coding downstream 202936 952494 ~ 954953 (+)
CI01000016_00959079_00960728 NA coding downstream 209095 958653 ~ 961060 (+)
CI01000016_00972599_01002933 NA coding downstream 222554 972112 ~ 1003172 (+)
G93349 NA non-coding upstream 19613 729504 ~ 729730 (+)
G93348 NA non-coding upstream 22614 726529 ~ 726729 (+)
G93343 NA non-coding upstream 42043 706817 ~ 707300 (+)
G93342 NA non-coding upstream 43893 704868 ~ 705450 (+)
G93341 NA non-coding upstream 44910 704171 ~ 704433 (+)
G93357 NA non-coding downstream 2965 752523 ~ 752757 (+)
G93358 NA non-coding downstream 4043 753601 ~ 753839 (+)
G93359 NA non-coding downstream 9628 759186 ~ 773268 (+)
G93364 NA non-coding downstream 24236 773794 ~ 774244 (+)
G93367 NA non-coding downstream 29217 778775 ~ 779171 (+)
G93406 NA other downstream 155842 905400 ~ 927532 (+)
G95439 NA other downstream 3112617 3862175 ~ 3862305 (+)
G95648 NA other downstream 3523078 4272636 ~ 4273905 (+)
CI01000016_04829592_04837305 NA other downstream 4085000 4829592 ~ 4837457 (+)
G95792 NA other downstream 4470322 5219880 ~ 5225941 (+)

Expression


Co-expression Network