G95091


Basic Information

Item Value
gene id G95091
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 2521721 ~ 2522003 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU108201
ACATTTTTTATTAAGGCAACGTATATTACATAATACGGATATATATCACTATAGTTATATTTAACCCGTCTGTTATTGCTGTGGAAAGAATCGCGCTTTTTCATGGCCTGTTGAAAGTACCTTGTTGATGCTTTTACACATTTAAATTTCCTTTTAATGTTCGTTGGTTGAAGGGTGAGTAGAATAATGTCATCTCATTGTACCCAGTTTAAAAATAAAATGTATTATTGCGTTCATAGAGCGAGCCTTTCACTGACTGTTTACAGCTTAACGGAAGTTACAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU108201 True 283 lncRNA 0.34 1 2521721 2522003

Neighbor

gene id symbol gene type direction distance location
CI01000016_02467451_02477544 NA coding downstream 44177 2467451 ~ 2477544 (-)
CI01000016_02328065_02334778 NA coding downstream 185985 2327812 ~ 2335736 (-)
CI01000016_02288848_02311105 PLEKHO1B coding downstream 210616 2287297 ~ 2311105 (-)
CI01000016_02263634_02265929 MRAP2, MRAP2A coding downstream 255792 2263245 ~ 2265929 (-)
CI01000016_02120276_02136906 NA coding downstream 384536 2120156 ~ 2137185 (-)
CI01000016_02568824_02575674 DECR1 coding upstream 46607 2568610 ~ 2575674 (-)
CI01000016_02589744_02622875 NA coding upstream 67472 2589475 ~ 2622875 (-)
CI01000016_02679833_02695963 SH3BP5B, SH3BP5 coding upstream 156535 2678538 ~ 2695963 (-)
CI01000016_02802780_02815803 NA coding upstream 280596 2802599 ~ 2815803 (-)
CI01000016_02817855_02829699 NA coding upstream 295852 2817855 ~ 2830457 (-)
G94796 NA non-coding downstream 75560 2433192 ~ 2446161 (-)
G94768 NA non-coding downstream 272049 2242223 ~ 2249672 (-)
G94751 NA non-coding downstream 324226 2197265 ~ 2197495 (-)
G94748 NA non-coding downstream 341261 2180254 ~ 2180460 (-)
G94674 NA non-coding downstream 371132 2150363 ~ 2150589 (-)
G95100 NA non-coding upstream 6024 2528027 ~ 2537970 (-)
G95102 NA non-coding upstream 19580 2541583 ~ 2541802 (-)
G95103 NA non-coding upstream 19970 2541973 ~ 2542218 (-)
G95061 NA non-coding upstream 59255 2581258 ~ 2581720 (-)
G95121 NA non-coding upstream 128904 2650907 ~ 2651108 (-)
G94786 NA other downstream 245446 2270836 ~ 2276275 (-)
G95070 NA other upstream 463257 2985260 ~ 2985641 (-)
CI01000016_03647744_03675574 NA other upstream 1113604 3647653 ~ 3675585 (-)
CI01000016_03921124_03930996 NA other upstream 1343758 3920055 ~ 3931162 (-)
CI01000016_04921091_04922518 NA other upstream 2390705 4918975 ~ 4922518 (-)
CI01000016_05325805_05330265 COX6B2 other upstream 2803516 5325519 ~ 5332874 (-)

Expression


Co-expression Network