G94905


Basic Information

Item Value
gene id G94905
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 2816089 ~ 2816299 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU107999
GCCAAAGAGATAGAAGTGGTAAGATTTATGTGCCTCTCAAGTGCATAACAGCCATGAGCAATGTGTTTCAACAGGTCTACAGGTATGTGAGTTGAACGTGAGTGACTTGAACTCAAGAATGTACATCAGTACAAAGAGCACTGCGCATGATTCACAGCGGAATTGCATACATTTGATTTCCAGTAAGAAACCCATTGATTGCATGATTCAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU107999 True 211 lncRNA 0.41 1 2816089 2816299

Neighbor

gene id symbol gene type direction distance location
CI01000016_02793868_02796984 EVA1BA coding upstream 18756 2793868 ~ 2797333 (+)
CI01000016_02741163_02753993 STK40 coding upstream 62036 2741163 ~ 2754053 (+)
CI01000016_02722831_02730864 OSCP1B, OSCP1 coding upstream 84511 2722831 ~ 2731578 (+)
CI01000016_02719966_02722011 MRPS15, PL8L1 coding upstream 93898 2719966 ~ 2722191 (+)
CI01000016_02714495_02719654 NA coding upstream 96343 2714412 ~ 2719746 (+)
CI01000016_02876373_02882129 NA coding downstream 59888 2876187 ~ 2882148 (+)
CI01000016_02918064_02918435 NA coding downstream 101465 2917764 ~ 2918540 (+)
CI01000016_02965137_02979305 SCMH1 coding downstream 148838 2965137 ~ 2979509 (+)
CI01000016_03050072_03055313 CTPS1A, CTPS1, CTPS1B coding downstream 232243 3048542 ~ 3055370 (+)
CI01000016_03056468_03058753 TAF12 coding downstream 240169 3056468 ~ 3059289 (+)
G94904 NA non-coding upstream 3538 2812343 ~ 2812551 (+)
G94901 NA non-coding upstream 81844 2733748 ~ 2734245 (+)
G94898 NA non-coding upstream 124078 2691683 ~ 2692011 (+)
G94874 NA non-coding upstream 271084 2544751 ~ 2545005 (+)
G94850 NA non-coding upstream 307198 2508643 ~ 2508891 (+)
G94858 NA non-coding downstream 1088 2817387 ~ 2822216 (+)
G94906 NA non-coding downstream 14441 2830740 ~ 2832069 (+)
G94908 NA non-coding downstream 19093 2835392 ~ 2835705 (+)
G94909 NA non-coding downstream 21408 2837707 ~ 2837932 (+)
G94910 NA non-coding downstream 21830 2838129 ~ 2838331 (+)
G93406 NA other upstream 1888557 905400 ~ 927532 (+)
G95439 NA other downstream 1045876 3862175 ~ 3862305 (+)
G95648 NA other downstream 1456337 4272636 ~ 4273905 (+)
CI01000016_04829592_04837305 NA other downstream 2018259 4829592 ~ 4837457 (+)
G95792 NA other downstream 2403581 5219880 ~ 5225941 (+)
CI01000016_05405791_05407797 AICDA other downstream 2589570 5405791 ~ 5407963 (+)

Expression


Co-expression Network