G95380



Basic Information


Item Value
gene id G95380
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 3406432 ~ 3406702 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU108506
GTTGCAGCCTTTAGCTTCCTTGTTAGAGCGTCCGACTCCCACGCCGGAGACCCAGGTTCGAGGCCTGCGAAGAGTGGGGCGAGTAGGTCCTGGGTAGAGGGGTTACATTGGTGCCGTGACCCAGATGGGAGTGAGGTTTAGGGGGGTGAGTGTAACGGAGGCCAGCTAGTAGTTGCTGTGCAAGTAAACCTCACTCCTCTGATCTCAAGAGATACTCTAGCGACTGATGCTAGAGGTTGCAGCCTTTTGCCTCCTTGTTAGAGCGTCCGAC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU108506 True 271 lncRNA 0.56 1 3406432 3406702

Neighbor


gene id symbol gene type direction distance location
CI01000016_03322103_03326683 NA coding downstream 75670 3322003 ~ 3330762 (-)
CI01000016_03082653_03084658 NA coding downstream 321774 3082386 ~ 3084658 (-)
CI01000016_03072793_03080040 NA coding downstream 326392 3072728 ~ 3080040 (-)
CI01000016_03064633_03068201 NA coding downstream 337340 3064562 ~ 3069092 (-)
CI01000016_03062846_03063013 NA coding downstream 343160 3062846 ~ 3063272 (-)
CI01000016_03555967_03558776 C1H1ORF43, CUNH1ORF43 coding upstream 148598 3555300 ~ 3559186 (-)
CI01000016_03647744_03675574 NA coding upstream 240951 3647653 ~ 3675585 (-)
CI01000016_03719404_03722988 NA coding upstream 312465 3719167 ~ 3723058 (-)
CI01000016_03834829_03843163 ZNF687 coding upstream 427798 3834500 ~ 3843266 (-)
CI01000016_03881771_03883341 NA coding upstream 473791 3880493 ~ 3883466 (-)
G95376 NA non-coding downstream 1572 3398182 ~ 3404860 (-)
G95315 NA non-coding downstream 80257 3325912 ~ 3326175 (-)
G95313 NA non-coding downstream 81750 3324367 ~ 3324682 (-)
G95210 NA non-coding downstream 299984 3105760 ~ 3106448 (-)
G95387 NA non-coding upstream 4537 3411239 ~ 3411521 (-)
G96569 NA non-coding upstream 29508 3436210 ~ 3437197 (-)
G96592 NA non-coding upstream 104601 3511303 ~ 3511652 (-)
G96597 NA non-coding upstream 121849 3528551 ~ 3528890 (-)
G96599 NA non-coding upstream 123873 3530575 ~ 3530946 (-)
G95070 NA other downstream 420791 2985260 ~ 2985641 (-)
G94786 NA other downstream 1130157 2270836 ~ 2276275 (-)
CI01000016_03921124_03930996 NA other upstream 459059 3920055 ~ 3931162 (-)
CI01000016_04921091_04922518 NA other upstream 1506006 4918975 ~ 4922518 (-)
CI01000016_05325805_05330265 COX6B2 other upstream 1918817 5325519 ~ 5332874 (-)
CI01000016_05412782_05415867 NA other upstream 2005557 5412248 ~ 5415906 (-)

Expression



Co-expression Network