G96788


Basic Information

Item Value
gene id G96788
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 4065535 ~ 4065881 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU110122
CGAAGATCAACGAAGGTCTTACGGGTGTAAAACGGCACGAGGGTGAGTAATTAATGACAGAATTTTCATTTTTGGGTGAACTAACCCTTTAAGAACACATATTGAGAAATAGCTGGCAGAAATAAGGCCGTCCTGAAGACGGCGCGGTTTGACCAATCAGATGAAAGGGGCGTTTCAGCGCCGCCCACATGTGCGAATGAAATATCAAAGCCATAAACCGAAAAAAAAAGGGAAATCGGGCCAAAATCTAATTTTCCGTTTGTTAAACTAAATGAAAAAACAAATAAACAAGCTATCTATTCATTTCTCGTTATTCCATTCCAAATAGGAAATGAAATGATCAAAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU110122 True 347 lncRNA 0.39 1 4065535 4065881

Neighbor

gene id symbol gene type direction distance location
CI01000016_04044171_04047247 TRIM108 coding downstream 18230 4044015 ~ 4047305 (-)
CI01000016_03921124_03930996 NA coding downstream 134373 3920055 ~ 3931162 (-)
CI01000016_03881771_03883341 NA coding downstream 182069 3880493 ~ 3883466 (-)
CI01000016_03834829_03843163 ZNF687 coding downstream 222269 3834500 ~ 3843266 (-)
CI01000016_03719404_03722988 NA coding downstream 342477 3719167 ~ 3723058 (-)
CI01000016_04084854_04101874 PIANP coding upstream 18843 4084724 ~ 4101953 (-)
CI01000016_04181435_04188590 FLOT1B, FLOT1, FLOT1A coding upstream 115382 4181263 ~ 4188590 (-)
CI01000016_04226585_04232287 NA coding upstream 160558 4226439 ~ 4232287 (-)
CI01000016_04264738_04270463 ABHD16A coding upstream 198048 4263929 ~ 4272171 (-)
CI01000016_04277441_04297655 NA coding upstream 211077 4276958 ~ 4298217 (-)
G96742 NA non-coding downstream 184 4003345 ~ 4065351 (-)
G96736 NA non-coding downstream 72712 3992611 ~ 3992823 (-)
G96724 NA non-coding downstream 76721 3986802 ~ 3988814 (-)
G96723 NA non-coding downstream 81531 3980704 ~ 3984004 (-)
G96729 NA non-coding downstream 91487 3973807 ~ 3974048 (-)
G96789 NA non-coding upstream 2472 4068353 ~ 4068554 (-)
G96793 NA non-coding upstream 52416 4118297 ~ 4120351 (-)
G96792 NA non-coding upstream 54635 4120516 ~ 4122375 (-)
G96810 NA non-coding upstream 116620 4182501 ~ 4182967 (-)
G96758 NA non-coding upstream 256524 4322405 ~ 4367971 (-)
CI01000016_03647744_03675574 NA other downstream 400222 3647653 ~ 3675585 (-)
G95070 NA other downstream 1079894 2985260 ~ 2985641 (-)
G94786 NA other downstream 1789260 2270836 ~ 2276275 (-)
CI01000016_04921091_04922518 NA other upstream 846827 4918975 ~ 4922518 (-)
CI01000016_05325805_05330265 COX6B2 other upstream 1259638 5325519 ~ 5332874 (-)
CI01000016_05412782_05415867 NA other upstream 1346378 5412248 ~ 5415906 (-)
G97341 NA other upstream 2093105 6158986 ~ 6159721 (-)
CI01000016_08893013_08893496 NPPCL, ANFC1 other upstream 4822952 8888833 ~ 8894737 (-)

Expression


Co-expression Network