G95892



Basic Information


Item Value
gene id G95892
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 5500417 ~ 5500794 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU109059
TTAATTTTTGAAGCTTTTTTTCACATAAAAGTGTGAAAACTGATGGTCGAATTGAATTTAGCCGAGGAGGAACAATGAGGTATGTCTTTATTTATTTATTTTTTATGCCGTCTTACGTTTGAATAACTAAATTAATGCTATGCCTGACTATTTAAGTGACTATATTCTGATTATAAACTAAATATTACTACTGATGCTCAACACACCAGCAAATGACATCTCACCGGAAGTTTTCGAGCTGGCTTATATTAATGCGGAAGTTCTAAAGAACGCTCCGTGCATATAGCCCATTCCTAACTCCTATTCCTAACCCCACACCTACTCCTAAACTTACCAATACTAGGGGTAGTAATCTGGCAGGGGGTCGAAATTCAGCAC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU109059 True 378 lncRNA 0.37 1 5500417 5500794
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000016_05475350_05482964 U2AF2, U2AF2A, U2AF2B coding upstream 16471 5475350 ~ 5483946 (+)
CI01000016_05445824_05454816 EPN1 coding upstream 45001 5445824 ~ 5455416 (+)
CI01000016_05405791_05407797 AICDA coding upstream 92454 5405791 ~ 5407963 (+)
CI01000016_05398036_05400369 NAT14 coding upstream 100011 5398036 ~ 5400406 (+)
CI01000016_05388832_05396460 ZNF628 coding upstream 103337 5388832 ~ 5397080 (+)
CI01000016_05698858_05706081 NA coding downstream 198064 5698858 ~ 5706719 (+)
CI01000016_05797506_05798075 NA coding downstream 296712 5797506 ~ 5799585 (+)
CI01000016_05828974_05833309 JOSD2, JOS2 coding downstream 327604 5828398 ~ 5833377 (+)
CI01000016_05837368_05837667 NA coding downstream 335789 5836583 ~ 5837927 (+)
CI01000016_05878037_05885761 FLCN coding downstream 377243 5878037 ~ 5886192 (+)
G95891 NA non-coding upstream 275 5499790 ~ 5500142 (+)
G95890 NA non-coding upstream 762 5499358 ~ 5499655 (+)
G95889 NA non-coding upstream 1460 5498268 ~ 5498957 (+)
G95888 NA non-coding upstream 3575 5496643 ~ 5496842 (+)
G95831 NA non-coding upstream 5503 5494241 ~ 5494914 (+)
G95893 NA non-coding downstream 34 5500828 ~ 5501124 (+)
G95894 NA non-coding downstream 337 5501131 ~ 5501351 (+)
G95811 NA non-coding downstream 18344 5519138 ~ 5528039 (+)
G95896 NA non-coding downstream 44945 5545739 ~ 5545986 (+)
G95897 NA non-coding downstream 45352 5546146 ~ 5546391 (+)
G95792 NA other upstream 274476 5219880 ~ 5225941 (+)
CI01000016_04829592_04837305 NA other upstream 663762 4829592 ~ 4837457 (+)
G95648 NA other upstream 1226512 4272636 ~ 4273905 (+)
G95439 NA other upstream 1636560 3862175 ~ 3862305 (+)
G96389 NA other downstream 1659847 7160641 ~ 7161290 (+)
CI01000016_07784248_07784757 TWIST1, TWIST1.L, TWIST1A, TWIST1B, TWST2, TWIST1.S other downstream 2283271 7783987 ~ 7784996 (+)
G97824 NA other downstream 2513569 8014363 ~ 8015775 (+)
G98288 NA other downstream 3495304 8996098 ~ 9002717 (+)
CI01000016_09796196_09842235 NA other downstream 4294837 9795950 ~ 9842576 (+)

Expression


G95892 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G95892 Expression in each Bioproject

Bar chart with 40 bars.
G95892 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network