G97180


Basic Information

Item Value
gene id G97180
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 5553295 ~ 5553986 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU110571
GTAATGCTGCTTTGTAAAGTATCTTGGTCAAGCTATGTTTATGGGGGTGGAAGGGGGACTATCCTGCCCCCTCAGTCAAGATGAATGTGAAAATAGATTTTAATCATGAAATATAATCAACAGACTATTTTAAAAATCACAATTGCCATGTGCATAGGCTTTCTAACATTAAAGGGTTAGTTCACCCAAAAATGAAAATTCTGTCATTAATTACTCACCCTTGTGCCGTTTTACACCCTTAAGACCTTCGATGATCTTCGGAACACAAATTAAGATATTTTTGTTTAAATCCGATGACTCAGTGAGGCCTACATAGGGAGCAATGACATTTCCTCTCTCAAGATCCATTAATGTACTAAAAACATATTTAAATCAGTCCATGTGAGTACAGTGGTTCAATATTAATATTATAAAGCGACGAGAATATTTTTGGAGCGTAATGAATCAGCGTGTCGAATCATGATTCGGATCGTGTGTCAAACCGCCAAACTGCTGAAATCACGTGACTTTGGCGCTCCGAACTGCGGATTCGACACGCTGTCACCGGCTCTGTATTTGTGGTGCTGGTGTATTTGGATATGTCTGTACTAGCTTTGCACACCTAGATTGGCGAATATTTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU110571 True 620 lncRNA 0.39 2 5553295 5553986

Neighbor

gene id symbol gene type direction distance location
CI01000016_05508930_05523828 CACNG8B coding downstream 29467 5508087 ~ 5523828 (-)
CI01000016_05468882_05473383 ISOC2 coding downstream 79912 5468763 ~ 5473383 (-)
CI01000016_05461674_05464777 FOXJ2 coding downstream 88518 5461674 ~ 5464777 (-)
CI01000016_05426889_05429942 NA coding downstream 123353 5425776 ~ 5429942 (-)
CI01000016_05412782_05415867 NA coding downstream 137428 5412248 ~ 5415906 (-)
CI01000016_05565004_05596591 PRKCG coding upstream 10982 5564968 ~ 5596591 (-)
CI01000016_05615909_05656109 GRIN2D coding upstream 60781 5614767 ~ 5656109 (-)
CI01000016_05734861_05742853 NA coding upstream 180576 5734562 ~ 5742853 (-)
CI01000016_05759240_05762146 NA coding upstream 204998 5758984 ~ 5763974 (-)
CI01000016_05765402_05775268 NTD5 coding upstream 210790 5764776 ~ 5775297 (-)
G97165 NA non-coding downstream 141375 5411655 ~ 5411920 (-)
G97160 NA non-coding downstream 150926 5402143 ~ 5402369 (-)
CI01000016_05374626_05378364 NA non-coding downstream 166830 5373845 ~ 5386465 (-)
G97148 NA non-coding downstream 211495 5341039 ~ 5341800 (-)
G97012 NA non-coding downstream 348482 5192792 ~ 5204813 (-)
G97203 NA non-coding upstream 11211 5565197 ~ 5566153 (-)
G97215 NA non-coding upstream 12307 5566293 ~ 5573569 (-)
G97252 NA non-coding upstream 223418 5777404 ~ 5777668 (-)
G97255 NA non-coding upstream 280584 5834570 ~ 5834911 (-)
G97185 NA non-coding upstream 327391 5881377 ~ 5887097 (-)
CI01000016_05325805_05330265 COX6B2 other downstream 222449 5325519 ~ 5332874 (-)
CI01000016_04921091_04922518 NA other downstream 629891 4918975 ~ 4922518 (-)
CI01000016_03921124_03930996 NA other downstream 1622244 3920055 ~ 3931162 (-)
CI01000016_03647744_03675574 NA other downstream 1887982 3647653 ~ 3675585 (-)
G97341 NA other upstream 605000 6158986 ~ 6159721 (-)
CI01000016_08893013_08893496 NPPCL, ANFC1 other upstream 3334847 8888833 ~ 8894737 (-)
CI01000016_08926089_08945071 NA other upstream 3382803 8925960 ~ 8945229 (-)
G98679 NA other upstream 3681010 9234996 ~ 9239929 (-)
G98691 NA other upstream 3702116 9256102 ~ 9257611 (-)

Expression


Co-expression Network