G95905


Basic Information

Item Value
gene id G95905
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 5600788 ~ 5601022 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU109074
TTTTAAAGGGGAGTGTTTTATCATCAGTTTGCTAAGCAATGCAGTTTGCTGAGCAATGCTGCTTAATAAGAATGAAACAAAACTTCTCACAAATTTCTCATCTGAAAGGGGCATAAACTGTAGGTAATCACAGCAACAGATTATGTATTTTTTAGTGCTGTCAAACGATTATACATTTAATACATGTATATATATTAAAGTAATATATTTAATATAAAACTAATATAAATATTTT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU109074 True 235 lncRNA 0.27 1 5600788 5601022

Neighbor

gene id symbol gene type direction distance location
CI01000016_05488887_05502270 CACNG6B coding upstream 98438 5484205 ~ 5504239 (+)
CI01000016_05475350_05482964 U2AF2, U2AF2A, U2AF2B coding upstream 116842 5475350 ~ 5483946 (+)
CI01000016_05445824_05454816 EPN1 coding upstream 145372 5445824 ~ 5455416 (+)
CI01000016_05405791_05407797 AICDA coding upstream 192825 5405791 ~ 5407963 (+)
CI01000016_05398036_05400369 NAT14 coding upstream 200382 5398036 ~ 5400406 (+)
CI01000016_05698858_05706081 NA coding downstream 97836 5698858 ~ 5706719 (+)
CI01000016_05797506_05798075 NA coding downstream 196484 5797506 ~ 5799585 (+)
CI01000016_05828974_05833309 JOSD2, JOS2 coding downstream 227376 5828398 ~ 5833377 (+)
CI01000016_05837368_05837667 NA coding downstream 235561 5836583 ~ 5837927 (+)
CI01000016_05878037_05885761 FLCN coding downstream 277015 5878037 ~ 5886192 (+)
G95902 NA non-coding upstream 18894 5579571 ~ 5581894 (+)
G95813 NA non-coding upstream 34635 5565212 ~ 5566153 (+)
G95898 NA non-coding upstream 37178 5563315 ~ 5563610 (+)
G95897 NA non-coding upstream 54397 5546146 ~ 5546391 (+)
G95896 NA non-coding upstream 54802 5545739 ~ 5545986 (+)
G95906 NA non-coding downstream 142 5601164 ~ 5601424 (+)
G95908 NA non-coding downstream 1784 5602806 ~ 5603260 (+)
G95909 NA non-coding downstream 2280 5603302 ~ 5603833 (+)
G95910 NA non-coding downstream 3120 5604142 ~ 5604959 (+)
G95911 NA non-coding downstream 3949 5604971 ~ 5605216 (+)
G95792 NA other upstream 374847 5219880 ~ 5225941 (+)
CI01000016_04829592_04837305 NA other upstream 764133 4829592 ~ 4837457 (+)
G95648 NA other upstream 1326883 4272636 ~ 4273905 (+)
G95439 NA other upstream 1736931 3862175 ~ 3862305 (+)
G96389 NA other downstream 1559619 7160641 ~ 7161290 (+)
CI01000016_07784248_07784757 TWIST1, TWIST1.L, TWIST1A, TWIST1B, TWST2, TWIST1.S other downstream 2183043 7783987 ~ 7784996 (+)
G97824 NA other downstream 2413341 8014363 ~ 8015775 (+)
G98288 NA other downstream 3395076 8996098 ~ 9002717 (+)
CI01000016_09796196_09842235 NA other downstream 4194609 9795950 ~ 9842576 (+)

Expression


Co-expression Network