G95911



Basic Information


Item Value
gene id G95911
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 5604971 ~ 5605216 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU109080
CGCAACCATGCCCTGGGGGCGTCAATTCACAAGGTAATCAAAGAAAAACTGCATAAACAGAACAGAACGGCTACAATGGAAGCTACAGCAACAATGGAGGCCTACATAGACGAAAGATTGTGTGAAAAGGTTAGAAAGTACCCTCATTTGTACAACTCTAGCATGAAAGAATACAAAGATGTTTACATGGGTTGTAACTCGTGGCTAGAGATCGTTCAAAACTGTGCATGCATCGAATGCCTGTGT

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU109080 True 246 lncRNA 0.43 1 5604971 5605216

Neighbor


gene id symbol gene type direction distance location
CI01000016_05488887_05502270 CACNG6B coding upstream 102621 5484205 ~ 5504239 (+)
CI01000016_05475350_05482964 U2AF2, U2AF2A, U2AF2B coding upstream 121025 5475350 ~ 5483946 (+)
CI01000016_05445824_05454816 EPN1 coding upstream 149555 5445824 ~ 5455416 (+)
CI01000016_05405791_05407797 AICDA coding upstream 197008 5405791 ~ 5407963 (+)
CI01000016_05398036_05400369 NAT14 coding upstream 204565 5398036 ~ 5400406 (+)
CI01000016_05698858_05706081 NA coding downstream 93642 5698858 ~ 5706719 (+)
CI01000016_05797506_05798075 NA coding downstream 192290 5797506 ~ 5799585 (+)
CI01000016_05828974_05833309 JOSD2, JOS2 coding downstream 223182 5828398 ~ 5833377 (+)
CI01000016_05837368_05837667 NA coding downstream 231367 5836583 ~ 5837927 (+)
CI01000016_05878037_05885761 FLCN coding downstream 272821 5878037 ~ 5886192 (+)
G95910 NA non-coding upstream 12 5604142 ~ 5604959 (+)
G95909 NA non-coding upstream 1138 5603302 ~ 5603833 (+)
G95908 NA non-coding upstream 1711 5602806 ~ 5603260 (+)
G95906 NA non-coding upstream 3547 5601164 ~ 5601424 (+)
G95905 NA non-coding upstream 3949 5600788 ~ 5601022 (+)
G95912 NA non-coding downstream 203 5605419 ~ 5605986 (+)
G95913 NA non-coding downstream 776 5605992 ~ 5606273 (+)
G95914 NA non-coding downstream 1487 5606703 ~ 5607343 (+)
G95915 NA non-coding downstream 2411 5607627 ~ 5607909 (+)
G95918 NA non-coding downstream 5662 5610878 ~ 5615490 (+)
G95792 NA other upstream 379030 5219880 ~ 5225941 (+)
CI01000016_04829592_04837305 NA other upstream 768316 4829592 ~ 4837457 (+)
G95648 NA other upstream 1331066 4272636 ~ 4273905 (+)
G95439 NA other upstream 1741114 3862175 ~ 3862305 (+)
G96389 NA other downstream 1555425 7160641 ~ 7161290 (+)
CI01000016_07784248_07784757 TWIST1, TWIST1.L, TWIST1A, TWIST1B, TWST2, TWIST1.S other downstream 2178849 7783987 ~ 7784996 (+)
G97824 NA other downstream 2409147 8014363 ~ 8015775 (+)
G98288 NA other downstream 3390882 8996098 ~ 9002717 (+)
CI01000016_09796196_09842235 NA other downstream 4190415 9795950 ~ 9842576 (+)

Expression



Co-expression Network