G96095


Basic Information

Item Value
gene id G96095
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 6080752 ~ 6081244 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU109293
GTTTGTACTGTGGTATGATGTAGTATTCGTCGCCGTGGTAGATGTAAAGAGCTCCCTGGTGGTCATCCTCTAGCGGAGCTCCCACGAGCAGATCAGCGTATCCATCATGGTTTAAGTCATTGGCTACAGCCATAGCATAACCAAAGCGTGCATCCTGTGCCTTCTGAGAATGCAGCGTACCGTTAGGTGCAAAACCATCCCCATCCAGACAGTAGATATAGACTTTGCCTGTTTC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU109293 True 235 lncRNA 0.49 2 6080752 6081244

Neighbor

gene id symbol gene type direction distance location
CI01000016_06058748_06068258 POLR3C coding upstream 12104 6058748 ~ 6068648 (+)
CI01000016_06038939_06045122 GBA coding upstream 35350 6038939 ~ 6045402 (+)
CI01000016_06030950_06038330 DAP3 coding upstream 42422 6030950 ~ 6038330 (+)
CI01000016_05966893_05982233 RUSC1 coding upstream 98107 5964215 ~ 5982645 (+)
CI01000016_05960829_05963788 FDPS, FPPS coding upstream 116964 5960829 ~ 5963788 (+)
CI01000016_06158996_06159538 NA coding downstream 77478 6158722 ~ 6159725 (+)
CI01000016_06174800_06210259 DEPDC6, DEPTOR coding downstream 93556 6174800 ~ 6211031 (+)
CI01000016_06270425_06375483 COL14A1A, COL14A1 coding downstream 189181 6270425 ~ 6375483 (+)
CI01000016_06398455_06420062 MTBP coding downstream 317211 6398455 ~ 6420138 (+)
CI01000016_06684506_06687365 NA coding downstream 603262 6684506 ~ 6687405 (+)
G96092 NA non-coding upstream 2457 6076378 ~ 6078295 (+)
G96087 NA non-coding upstream 84032 5996498 ~ 5996720 (+)
G95967 NA non-coding upstream 95928 5984065 ~ 5984824 (+)
G96079 NA non-coding upstream 145961 5930392 ~ 5934791 (+)
G96096 NA non-coding downstream 91 6081335 ~ 6118470 (+)
G95949 NA non-coding downstream 131734 6212978 ~ 6213633 (+)
G96011 NA non-coding downstream 158592 6239836 ~ 6247237 (+)
G95974 NA non-coding downstream 294856 6376100 ~ 6376980 (+)
G96163 NA non-coding downstream 403333 6484577 ~ 6484776 (+)
CI01000016_05405791_05407797 AICDA other upstream 672889 5405791 ~ 5407963 (+)
G95792 NA other upstream 854811 5219880 ~ 5225941 (+)
CI01000016_04829592_04837305 NA other upstream 1244097 4829592 ~ 4837457 (+)
G95648 NA other upstream 1806847 4272636 ~ 4273905 (+)
G95439 NA other upstream 2216895 3862175 ~ 3862305 (+)
G96389 NA other downstream 1079397 7160641 ~ 7161290 (+)
CI01000016_07784248_07784757 TWIST1, TWIST1.L, TWIST1A, TWIST1B, TWST2, TWIST1.S other downstream 1702821 7783987 ~ 7784996 (+)
G97824 NA other downstream 1933119 8014363 ~ 8015775 (+)
G98288 NA other downstream 2914854 8996098 ~ 9002717 (+)
CI01000016_09796196_09842235 NA other downstream 3714387 9795950 ~ 9842576 (+)

Expression


Co-expression Network