G96163


Basic Information

Item Value
gene id G96163
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 6484577 ~ 6484776 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU109366
CTTTTCTCATCTGGACGGACCATCGGAATCTCACTTACATCCAGGACGCTAAGAGGTTAAACTCACGACAAGCCTGTTGGGCCCTCTTTTTTAACCGATTCAATTTCATCCACTCTTATCGCCCAGGTTCGAAAAATCTCAAGCCAGATACACTCTTAAGGCAGTCTGAACCACCTGAGAAGGAGTCTTGTCCAGAAACC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU109366 True 200 lncRNA 0.46 1 6484577 6484776

Neighbor

gene id symbol gene type direction distance location
CI01000016_06398455_06420062 MTBP coding upstream 64439 6398455 ~ 6420138 (+)
CI01000016_06270425_06375483 COL14A1A, COL14A1 coding upstream 109094 6270425 ~ 6375483 (+)
CI01000016_06174800_06210259 DEPDC6, DEPTOR coding upstream 273546 6174800 ~ 6211031 (+)
CI01000016_06158996_06159538 NA coding upstream 324852 6158722 ~ 6159725 (+)
CI01000016_06058748_06068258 POLR3C coding upstream 415929 6058748 ~ 6068648 (+)
CI01000016_06684506_06687365 NA coding downstream 199730 6684506 ~ 6687405 (+)
CI01000016_06756366_06782229 SETD2 coding downstream 271590 6756366 ~ 6782619 (+)
CI01000016_06813604_06813789 NA coding downstream 328828 6809807 ~ 6814285 (+)
CI01000016_06890651_06904100 NA coding downstream 405370 6890146 ~ 6904634 (+)
CI01000016_06954301_06958598 NA coding downstream 469525 6954301 ~ 6958603 (+)
G95974 NA non-coding upstream 107597 6376100 ~ 6376980 (+)
G96011 NA non-coding upstream 237340 6239836 ~ 6247237 (+)
G95949 NA non-coding upstream 270944 6212978 ~ 6213633 (+)
G96096 NA non-coding upstream 366107 6081335 ~ 6118470 (+)
G96095 NA non-coding upstream 403333 6080752 ~ 6081244 (+)
G96236 NA non-coding downstream 206414 6691190 ~ 6691843 (+)
G95992 NA non-coding downstream 242351 6727127 ~ 6727496 (+)
G96257 NA non-coding downstream 321945 6806721 ~ 6807026 (+)
G96299 NA non-coding downstream 438583 6923359 ~ 6924302 (+)
CI01000016_05405791_05407797 AICDA other upstream 1076714 5405791 ~ 5407963 (+)
G95792 NA other upstream 1258636 5219880 ~ 5225941 (+)
CI01000016_04829592_04837305 NA other upstream 1647922 4829592 ~ 4837457 (+)
G95648 NA other upstream 2210672 4272636 ~ 4273905 (+)
G95439 NA other upstream 2620720 3862175 ~ 3862305 (+)
G96389 NA other downstream 675865 7160641 ~ 7161290 (+)
CI01000016_07784248_07784757 TWIST1, TWIST1.L, TWIST1A, TWIST1B, TWST2, TWIST1.S other downstream 1299289 7783987 ~ 7784996 (+)
G97824 NA other downstream 1529587 8014363 ~ 8015775 (+)
G98288 NA other downstream 2511322 8996098 ~ 9002717 (+)
CI01000016_09796196_09842235 NA other downstream 3310855 9795950 ~ 9842576 (+)

Expression


Co-expression Network