G96257


Basic Information

Item Value
gene id G96257
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 6806721 ~ 6807026 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU109463
TTCACATCAACTTTATTTAGGCTTCATCTTTTACATTTCTGAACTTCAATACAGATTTACCAGCATATTAATTTCATCAGTTAACAAAATACAATTAAAGTAATACCACTAAAATCACATTAACACATAGTGCCAGTGGAAAGTAAATGTTGGAAATATAAGAATAAAAGTTTGAAGAGATAAAGTACTTAATTAGTAGCAGTATACAACAATAACCAGCGAATACATATAATCTTAAATCTTAAAACCACATGCTATAAAGAAAAGGGTCTTCTTTATTGCGACGACTCTTCCCCCCTGTCTCAC

Function

NR:

description
PREDICTED: WD repeat-containing protein 90 isoform X2

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU109463 True 306 lncRNA 0.30 1 6806721 6807026

Neighbor

gene id symbol gene type direction distance location
CI01000016_06756366_06782229 SETD2 coding upstream 24102 6756366 ~ 6782619 (+)
CI01000016_06684506_06687365 NA coding upstream 119316 6684506 ~ 6687405 (+)
CI01000016_06398455_06420062 MTBP coding upstream 386583 6398455 ~ 6420138 (+)
CI01000016_06270425_06375483 COL14A1A, COL14A1 coding upstream 431238 6270425 ~ 6375483 (+)
CI01000016_06174800_06210259 DEPDC6, DEPTOR coding upstream 595690 6174800 ~ 6211031 (+)
CI01000016_06813604_06813789 NA coding downstream 6578 6809807 ~ 6814285 (+)
CI01000016_06890651_06904100 NA coding downstream 83120 6890146 ~ 6904634 (+)
CI01000016_06954301_06958598 NA coding downstream 147275 6954301 ~ 6958603 (+)
CI01000016_07178060_07180135 NA coding downstream 371034 7178060 ~ 7180810 (+)
CI01000016_07214392_07233533 RXRBB, RXRBA, RXRB coding downstream 407366 7214392 ~ 7234962 (+)
G95992 NA non-coding upstream 79225 6727127 ~ 6727496 (+)
G96236 NA non-coding upstream 114878 6691190 ~ 6691843 (+)
G96163 NA non-coding upstream 321945 6484577 ~ 6484776 (+)
G95974 NA non-coding upstream 429741 6376100 ~ 6376980 (+)
G96011 NA non-coding upstream 559484 6239836 ~ 6247237 (+)
G96299 NA non-coding downstream 116333 6923359 ~ 6924302 (+)
G96305 NA non-coding downstream 123380 6930406 ~ 6935195 (+)
G96308 NA non-coding downstream 128662 6935688 ~ 6936001 (+)
G96314 NA non-coding downstream 153411 6960437 ~ 6960751 (+)
CI01000016_05405791_05407797 AICDA other upstream 1398858 5405791 ~ 5407963 (+)
G95792 NA other upstream 1580780 5219880 ~ 5225941 (+)
CI01000016_04829592_04837305 NA other upstream 1970066 4829592 ~ 4837457 (+)
G95648 NA other upstream 2532816 4272636 ~ 4273905 (+)
G95439 NA other upstream 2942864 3862175 ~ 3862305 (+)
G96389 NA other downstream 353615 7160641 ~ 7161290 (+)
CI01000016_07784248_07784757 TWIST1, TWIST1.L, TWIST1A, TWIST1B, TWST2, TWIST1.S other downstream 977039 7783987 ~ 7784996 (+)
G97824 NA other downstream 1207337 8014363 ~ 8015775 (+)
G98288 NA other downstream 2189072 8996098 ~ 9002717 (+)
CI01000016_09796196_09842235 NA other downstream 2988605 9795950 ~ 9842576 (+)

Expression


Co-expression Network