G96305


Basic Information

Item Value
gene id G96305
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 6930406 ~ 6935195 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU109531
GGATCCATTTGCAGCTAGTTTATTAAAAGGACTTACAGAGTAGACAGGGCAAAGGCAGAGGCATAAACAGTAACAGGCAATGGTCGAGGCAGGCGGCAGACGAACAGAAACAGGGTACAGGCAAGGATCAGGGCAGGCAGCAAACAATCACAGTCCAGGAAACAGGCAAAGATCAGGGTAGGCAGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU109531 True 186 lncRNA 0.51 2 6930406 6935195

Neighbor

gene id symbol gene type direction distance location
CI01000016_06890651_06904100 NA coding upstream 25772 6890146 ~ 6904634 (+)
CI01000016_06813604_06813789 NA coding upstream 116469 6809807 ~ 6814285 (+)
CI01000016_06756366_06782229 SETD2 coding upstream 147787 6756366 ~ 6782619 (+)
CI01000016_06684506_06687365 NA coding upstream 243001 6684506 ~ 6687405 (+)
CI01000016_06398455_06420062 MTBP coding upstream 510268 6398455 ~ 6420138 (+)
CI01000016_06954301_06958598 NA coding downstream 19106 6954301 ~ 6958603 (+)
CI01000016_07178060_07180135 NA coding downstream 242865 7178060 ~ 7180810 (+)
CI01000016_07214392_07233533 RXRBB, RXRBA, RXRB coding downstream 279197 7214392 ~ 7234962 (+)
CI01000016_07445055_07456795 SLC6A19B coding downstream 509860 7445055 ~ 7457431 (+)
CI01000016_07463735_07471367 NA coding downstream 528540 7463735 ~ 7471828 (+)
G96299 NA non-coding upstream 6104 6923359 ~ 6924302 (+)
G96257 NA non-coding upstream 123380 6806721 ~ 6807026 (+)
G95992 NA non-coding upstream 202910 6727127 ~ 6727496 (+)
G96236 NA non-coding upstream 238563 6691190 ~ 6691843 (+)
G96308 NA non-coding downstream 493 6935688 ~ 6936001 (+)
G96314 NA non-coding downstream 25242 6960437 ~ 6960751 (+)
G96317 NA non-coding downstream 28164 6963359 ~ 6963881 (+)
G96316 NA non-coding downstream 29936 6965131 ~ 6966188 (+)
G96318 NA non-coding downstream 32371 6967566 ~ 6969600 (+)
CI01000016_05405791_05407797 AICDA other upstream 1522543 5405791 ~ 5407963 (+)
G95792 NA other upstream 1704465 5219880 ~ 5225941 (+)
CI01000016_04829592_04837305 NA other upstream 2093751 4829592 ~ 4837457 (+)
G95648 NA other upstream 2656501 4272636 ~ 4273905 (+)
G95439 NA other upstream 3066549 3862175 ~ 3862305 (+)
G96389 NA other downstream 225446 7160641 ~ 7161290 (+)
CI01000016_07784248_07784757 TWIST1, TWIST1.L, TWIST1A, TWIST1B, TWST2, TWIST1.S other downstream 848870 7783987 ~ 7784996 (+)
G97824 NA other downstream 1079168 8014363 ~ 8015775 (+)
G98288 NA other downstream 2060903 8996098 ~ 9002717 (+)
CI01000016_09796196_09842235 NA other downstream 2860436 9795950 ~ 9842576 (+)

Expression


Co-expression Network