G96341


Basic Information

Item Value
gene id G96341
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 7059136 ~ 7059596 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU109589
ACTGGTATTGCAAGCAGTACCCCCCCTGCAATTGCAACACCTTCACCTGTGTTCCTCCTCTCTTGTGCTCTTCTTAGGGCATATTTTGCTGATTCTAGGTTTTTTCCAGCCTGTTCCAAAGCTGCTTTGGAATACTTTAATAATTCCTCAGCAGAATTCTTCTCTGTGTGTAATTTATCCATGGCCATGCGCTTTTCTTTCTTCTGATGCTCAATATTGCACTTCTCTCTAATAAGTTGCTCCATCCGTTCATCCAAATATCGCAGCTTTTCTTTAATCACTGTCTCTGTCTTTTTCATGCACTGTTCAGCGTGCTCAATATGTTCCCTGATTTGTCTGTAATTGGAGCACATGTCAGTGGTGGGATCTACATGTGCGTCCATGAGGGACTTGCAGATGTTACAGACAGAGACAATTCCCTCATTTAGAGTCCCAGAAACTGACTTCATAGACTGCAAATC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU109589 True 461 lncRNA 0.43 1 7059136 7059596

Neighbor

gene id symbol gene type direction distance location
CI01000016_06954301_06958598 NA coding upstream 100533 6954301 ~ 6958603 (+)
CI01000016_06890651_06904100 NA coding upstream 154502 6890146 ~ 6904634 (+)
CI01000016_06813604_06813789 NA coding upstream 245199 6809807 ~ 6814285 (+)
CI01000016_06756366_06782229 SETD2 coding upstream 276517 6756366 ~ 6782619 (+)
CI01000016_06684506_06687365 NA coding upstream 371731 6684506 ~ 6687405 (+)
CI01000016_07178060_07180135 NA coding downstream 118464 7178060 ~ 7180810 (+)
CI01000016_07214392_07233533 RXRBB, RXRBA, RXRB coding downstream 154796 7214392 ~ 7234962 (+)
CI01000016_07445055_07456795 SLC6A19B coding downstream 385459 7445055 ~ 7457431 (+)
CI01000016_07463735_07471367 NA coding downstream 404139 7463735 ~ 7471828 (+)
CI01000016_07484583_07551063 NA coding downstream 424987 7484583 ~ 7551063 (+)
G96339 NA non-coding upstream 1428 7057506 ~ 7057708 (+)
G96338 NA non-coding upstream 2036 7056417 ~ 7057100 (+)
G96335 NA non-coding upstream 9243 7049376 ~ 7049893 (+)
G96306 NA non-coding upstream 17350 6973117 ~ 7041786 (+)
G96307 NA non-coding upstream 19292 7004346 ~ 7039844 (+)
G96342 NA non-coding downstream 1629 7061225 ~ 7061427 (+)
G96344 NA non-coding downstream 3963 7063559 ~ 7063804 (+)
G96347 NA non-coding downstream 7643 7067239 ~ 7067621 (+)
G96350 NA non-coding downstream 11796 7071392 ~ 7072805 (+)
G96359 NA non-coding downstream 25772 7085368 ~ 7085785 (+)
CI01000016_05405791_05407797 AICDA other upstream 1651273 5405791 ~ 5407963 (+)
G95792 NA other upstream 1833195 5219880 ~ 5225941 (+)
CI01000016_04829592_04837305 NA other upstream 2222481 4829592 ~ 4837457 (+)
G95648 NA other upstream 2785231 4272636 ~ 4273905 (+)
G95439 NA other upstream 3195279 3862175 ~ 3862305 (+)
G96389 NA other downstream 101045 7160641 ~ 7161290 (+)
CI01000016_07784248_07784757 TWIST1, TWIST1.L, TWIST1A, TWIST1B, TWST2, TWIST1.S other downstream 724469 7783987 ~ 7784996 (+)
G97824 NA other downstream 954767 8014363 ~ 8015775 (+)
G98288 NA other downstream 1936502 8996098 ~ 9002717 (+)
CI01000016_09796196_09842235 NA other downstream 2736035 9795950 ~ 9842576 (+)

Expression


Co-expression Network