G97601


Basic Information

Item Value
gene id G97601
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 7159973 ~ 7160626 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU111074
CAGGCAGATAGAAAACAGGGAAAAACGCTCAGAAATTGTTGCTGGGCAAACAATACTTCGCGAGGAGTGTGTGTGTGTGTGGCTTAAATAGCTGGCTGACGTGAAACAGGTGCGCCGTAATCAGGCCAGGTATGTGGGCGCTTGGGATTTGTAGTCCAGTTAGTACTCGGGAGAGTGAGACCTCCGGTGGCCGATCGAGGGAACTTCGCTGGCATTCGTGACA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU111074 True 223 lncRNA 0.52 2 7159973 7160626

Neighbor

gene id symbol gene type direction distance location
CI01000016_07127481_07148708 NA coding downstream 11078 7127465 ~ 7148895 (-)
CI01000016_07118966_07120089 NA coding downstream 39884 7118855 ~ 7120089 (-)
CI01000016_07088885_07090963 NA coding downstream 68930 7088688 ~ 7091043 (-)
CI01000016_07056612_07073504 NA coding downstream 85994 7056382 ~ 7074008 (-)
CI01000016_06998707_07047702 NA coding downstream 112271 6998534 ~ 7047702 (-)
CI01000016_07191021_07191531 NA coding upstream 30382 7191008 ~ 7191791 (-)
CI01000016_07204062_07211287 NA coding upstream 43366 7203992 ~ 7212446 (-)
CI01000016_07242123_07296094 FHOD3 coding upstream 80147 7240773 ~ 7296702 (-)
CI01000016_07318179_07319855 NA coding upstream 157502 7318128 ~ 7319855 (-)
CI01000016_07421716_07426983 FHOD3B coding upstream 260964 7421590 ~ 7442256 (-)
G97594 NA non-coding downstream 36657 7122924 ~ 7123316 (-)
G97590 NA non-coding downstream 44147 7115592 ~ 7115826 (-)
G97589 NA non-coding downstream 44928 7114828 ~ 7115045 (-)
G97566 NA non-coding downstream 95384 7064344 ~ 7064589 (-)
G97603 NA non-coding upstream 723 7161349 ~ 7161572 (-)
G97640 NA non-coding upstream 300565 7461191 ~ 7461463 (-)
G97646 NA non-coding upstream 320585 7481211 ~ 7534573 (-)
G97656 NA non-coding upstream 390326 7550952 ~ 7552253 (-)
G97970 NA non-coding upstream 542992 7703618 ~ 7703843 (-)
G97341 NA other downstream 1000252 6158986 ~ 6159721 (-)
CI01000016_05412782_05415867 NA other downstream 1741756 5412248 ~ 5415906 (-)
CI01000016_05325805_05330265 COX6B2 other downstream 1829127 5325519 ~ 5332874 (-)
CI01000016_04921091_04922518 NA other downstream 2236569 4918975 ~ 4922518 (-)
CI01000016_03921124_03930996 NA other downstream 3228922 3920055 ~ 3931162 (-)
CI01000016_08893013_08893496 NPPCL, ANFC1 other upstream 1728207 8888833 ~ 8894737 (-)
CI01000016_08926089_08945071 NA other upstream 1776163 8925960 ~ 8945229 (-)
G98679 NA other upstream 2074370 9234996 ~ 9239929 (-)
G98691 NA other upstream 2095476 9256102 ~ 9257611 (-)
CI01000016_09510177_09512196 ID4 other upstream 2348996 9509622 ~ 9512428 (-)

Expression


Co-expression Network