G96392


Basic Information

Item Value
gene id G96392
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 7164603 ~ 7164834 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU109640
CTGTCATACGCTTTCTCCAAGTCTACAAACACACAGTGCAACTCTCTCTGACCATCCCTATACTTCTCCATCAATTTTCAGGGCAAAAATTGCATCAGTTGTGCTCTTTCTGGGCATGAAGCCATACTGCTGCTCACAAATTCCCACTACCTTCCTTAACCTAGCTTCCACTACTCTTTCCCATAGCTTCATTGTATGGCTCATTAACTTTATCCCCCTATAGTTGCTGCAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU109640 True 232 lncRNA 0.44 1 7164603 7164834

Neighbor

gene id symbol gene type direction distance location
CI01000016_06954301_06958598 NA coding upstream 206000 6954301 ~ 6958603 (+)
CI01000016_06890651_06904100 NA coding upstream 259969 6890146 ~ 6904634 (+)
CI01000016_06813604_06813789 NA coding upstream 350666 6809807 ~ 6814285 (+)
CI01000016_06756366_06782229 SETD2 coding upstream 381984 6756366 ~ 6782619 (+)
CI01000016_06684506_06687365 NA coding upstream 477198 6684506 ~ 6687405 (+)
CI01000016_07178060_07180135 NA coding downstream 13226 7178060 ~ 7180810 (+)
CI01000016_07214392_07233533 RXRBB, RXRBA, RXRB coding downstream 49558 7214392 ~ 7234962 (+)
CI01000016_07445055_07456795 SLC6A19B coding downstream 280221 7445055 ~ 7457431 (+)
CI01000016_07463735_07471367 NA coding downstream 298901 7463735 ~ 7471828 (+)
CI01000016_07484583_07551063 NA coding downstream 319749 7484583 ~ 7551063 (+)
G96383 NA non-coding upstream 24125 7140275 ~ 7140478 (+)
G96376 NA non-coding upstream 47141 7117230 ~ 7117462 (+)
G96365 NA non-coding upstream 58396 7105979 ~ 7106207 (+)
G96359 NA non-coding upstream 78818 7085368 ~ 7085785 (+)
G96350 NA non-coding upstream 91798 7071392 ~ 7072805 (+)
G96396 NA non-coding downstream 3849 7168683 ~ 7169000 (+)
G96397 NA non-coding downstream 17177 7182011 ~ 7182239 (+)
G96405 NA non-coding downstream 40317 7205151 ~ 7205501 (+)
G96406 NA non-coding downstream 40755 7205589 ~ 7211423 (+)
G96389 NA other upstream 3313 7160641 ~ 7161290 (+)
CI01000016_05405791_05407797 AICDA other upstream 1756740 5405791 ~ 5407963 (+)
G95792 NA other upstream 1938662 5219880 ~ 5225941 (+)
CI01000016_04829592_04837305 NA other upstream 2327948 4829592 ~ 4837457 (+)
G95648 NA other upstream 2890698 4272636 ~ 4273905 (+)
CI01000016_07784248_07784757 TWIST1, TWIST1.L, TWIST1A, TWIST1B, TWST2, TWIST1.S other downstream 619231 7783987 ~ 7784996 (+)
G97824 NA other downstream 849529 8014363 ~ 8015775 (+)
G98288 NA other downstream 1831264 8996098 ~ 9002717 (+)
CI01000016_09796196_09842235 NA other downstream 2630797 9795950 ~ 9842576 (+)
G99041 NA other downstream 2759584 9924418 ~ 9925654 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
eurasian perch (Perca fluviatilis) G233707 ipo5,kpnb3 non-coding NC_053135.1 CM020932.1 10277681 ~ 10278373 (+)
striped catfish (Pangasianodon hypophthalmus) G267801 LOC107739129 non-coding NC_047611.1 CM018557.1 12522186 ~ 12522521 (+)