G97760


Basic Information

Item Value
gene id G97760
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 7771638 ~ 7771965 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU111249
TGGAGATATGGAAATACATAGGTTGACAGGACATCGTATCATTGCATTCGGACCAAATGCAATCATTGGATAAACATTTTTTAATACTGAGACTTCCACTGAAGATATATGTACATTTAATATTTAGACCACTTCTACTATTAATTGCTATCACGATGTGAAGAGAGTTTCAACCAGTATAACAAAAAGTGTTTATAAACCAAATTGCCTACACTACCTTTAACAATCATTAATCATTCTCCTCATCGCCATGAATTAAGTTTATGGTTTATGGTATCAAAATTATCCCTGAACTTTGCAGTGGTAAATACGACTTGTGAGGGCATTT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU111249 True 328 lncRNA 0.33 1 7771638 7771965

Neighbor

gene id symbol gene type direction distance location
CI01000016_07759095_07759370 NA coding upstream 10364 7759095 ~ 7761274 (+)
CI01000016_07743396_07746536 MACC1 coding upstream 24255 7743088 ~ 7747383 (+)
CI01000016_07711605_07715888 SP8, SP8B coding upstream 55377 7711605 ~ 7716261 (+)
CI01000016_07484583_07551063 NA coding upstream 220575 7484583 ~ 7551063 (+)
CI01000016_07463735_07471367 NA coding upstream 299810 7463735 ~ 7471828 (+)
CI01000016_07784248_07784757 TWIST1, TWIST1.L, TWIST1A, TWIST1B, TWST2, TWIST1.S coding downstream 12022 7783987 ~ 7784996 (+)
CI01000016_07851297_07854401 NA coding downstream 78791 7850756 ~ 7854610 (+)
CI01000016_07937188_07955977 ANKRD44, ANKRD28B, ANKRD28 coding downstream 165223 7937188 ~ 7956457 (+)
CI01000016_07956184_07965721 C16H2ORF66 coding downstream 184106 7956071 ~ 7965940 (+)
CI01000016_07969424_07983149 HACL1 coding downstream 196363 7968328 ~ 7983566 (+)
G97724 NA non-coding upstream 119285 7652042 ~ 7652353 (+)
G96518 NA non-coding upstream 217098 7554210 ~ 7554540 (+)
G96453 NA non-coding upstream 440627 7329766 ~ 7331011 (+)
G96283 NA non-coding upstream 459760 7310044 ~ 7311878 (+)
G96415 NA non-coding upstream 485038 7285071 ~ 7286600 (+)
G97764 NA non-coding downstream 6106 7778071 ~ 7778392 (+)
G97745 NA non-coding downstream 53423 7825388 ~ 7827695 (+)
G97746 NA non-coding downstream 73951 7845916 ~ 7847529 (+)
G97747 NA non-coding downstream 75692 7847657 ~ 7859181 (+)
G97788 NA non-coding downstream 134259 7906224 ~ 7906558 (+)
G96389 NA other upstream 610348 7160641 ~ 7161290 (+)
CI01000016_05405791_05407797 AICDA other upstream 2363775 5405791 ~ 5407963 (+)
G95792 NA other upstream 2545697 5219880 ~ 5225941 (+)
CI01000016_04829592_04837305 NA other upstream 2934983 4829592 ~ 4837457 (+)
G95648 NA other upstream 3497733 4272636 ~ 4273905 (+)
G97824 NA other downstream 242398 8014363 ~ 8015775 (+)
G98288 NA other downstream 1224133 8996098 ~ 9002717 (+)
CI01000016_09796196_09842235 NA other downstream 2023666 9795950 ~ 9842576 (+)
G99041 NA other downstream 2152453 9924418 ~ 9925654 (+)

Expression


Co-expression Network