G98603


Basic Information

Item Value
gene id G98603
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 8552161 ~ 8552435 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU112209
AAAAGGTTAAAAAGAACAGCATTTATTCAAAATATAAATCTTTTCTAACAATATAAATCTTTACTATCACTTTTTATCAATTTAACACATCCATGCTGAATAAAAGTATTAATTTCTTTCAAAAAAAAGAAAGAAAAAAATTACTGACCCCAAACTTTTGAACGGTAGTGTATATTGTTACAAAAGATTTCTATTTTAAATAAATGCTGATATTTTTTTTTAAACTTTTTATTCATCAAAGAATCCTGAAAAAGTATCACAGGTTATAAAATAAT

Function

NR:

description
PREDICTED: caspase-3

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU112209 True 275 lncRNA 0.21 1 8552161 8552435

Neighbor

gene id symbol gene type direction distance location
CI01000016_08421119_08444481 PDE11AL coding downstream 107059 8421097 ~ 8445102 (-)
CI01000016_08385655_08387187 NA coding downstream 164500 8385576 ~ 8387661 (-)
CI01000016_08379971_08382899 CBX3B coding downstream 168125 8379283 ~ 8384036 (-)
CI01000016_08374296_08376159 SNX10B coding downstream 176002 8374250 ~ 8376159 (-)
CI01000016_08232249_08261533 TAX1BP1, TAX1BP1B coding downstream 290628 8231563 ~ 8261533 (-)
CI01000016_08570850_08582638 MPP6, MPP6A coding upstream 17858 8570293 ~ 8582907 (-)
CI01000016_08598259_08602660 NPY coding upstream 45796 8598231 ~ 8602660 (-)
CI01000016_08605369_08623062 STK31 coding upstream 52812 8605247 ~ 8623062 (-)
CI01000016_08642218_08643021 NA coding upstream 89006 8641441 ~ 8643021 (-)
CI01000016_08741387_08746007 NA coding upstream 188547 8740982 ~ 8746066 (-)
G98602 NA non-coding downstream 3470 8548477 ~ 8548691 (-)
G98600 NA non-coding downstream 4694 8547157 ~ 8547467 (-)
G98559 NA non-coding downstream 91594 8460356 ~ 8460567 (-)
G98558 NA non-coding downstream 92804 8459075 ~ 8459357 (-)
G98521 NA non-coding downstream 131445 8419344 ~ 8420716 (-)
G98607 NA non-coding upstream 55761 8608196 ~ 8608395 (-)
G98608 NA non-coding upstream 56128 8608563 ~ 8608890 (-)
G98612 NA non-coding upstream 63934 8616369 ~ 8616599 (-)
G98613 NA non-coding upstream 64809 8617244 ~ 8617464 (-)
G98615 NA non-coding upstream 67749 8620184 ~ 8620530 (-)
G97341 NA other downstream 2392440 6158986 ~ 6159721 (-)
CI01000016_05412782_05415867 NA other downstream 3133944 5412248 ~ 5415906 (-)
CI01000016_05325805_05330265 COX6B2 other downstream 3221315 5325519 ~ 5332874 (-)
CI01000016_04921091_04922518 NA other downstream 3628757 4918975 ~ 4922518 (-)
CI01000016_03921124_03930996 NA other downstream 4621110 3920055 ~ 3931162 (-)
CI01000016_08893013_08893496 NPPCL, ANFC1 other upstream 336398 8888833 ~ 8894737 (-)
CI01000016_08926089_08945071 NA other upstream 384354 8925960 ~ 8945229 (-)
G98679 NA other upstream 682561 9234996 ~ 9239929 (-)
G98691 NA other upstream 703667 9256102 ~ 9257611 (-)
CI01000016_09510177_09512196 ID4 other upstream 957187 9509622 ~ 9512428 (-)

Expression


Co-expression Network