G98221


Basic Information

Item Value
gene id G98221
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 8605223 ~ 8605440 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU111755
TCTGCCTTTACATATTTATTTTTATTTATTCCAGGAACACGAAACAGGTGTGAGGAACAAACAAACAAACACCTTTGTGTTTTTTTTCTTAGAAGAAAATTATAAAGAAAAAGGGCAAAGAACGCAAACATGAACACATTTCACTTTTACACATCAACTGAGATGAAGTAGTCATCCTTAAGGGCCTCAGAAGCAGACAGTCTTGTAGAGGAAATCAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU111755 True 218 lncRNA 0.35 1 8605223 8605440

Neighbor

gene id symbol gene type direction distance location
CI01000016_08553934_08565167 DFNA5 coding upstream 39977 8552843 ~ 8565246 (+)
CI01000016_08513514_08545976 OSBPL3B, OSBPL3 coding upstream 59086 8513514 ~ 8546137 (+)
CI01000016_08450823_08453343 NA coding upstream 151846 8450628 ~ 8453377 (+)
CI01000016_08390421_08396972 NA coding upstream 207468 8390289 ~ 8397755 (+)
CI01000016_08323079_08336573 SKAP2 coding upstream 268536 8323079 ~ 8336687 (+)
CI01000016_08628196_08630801 NA coding downstream 22756 8628196 ~ 8631378 (+)
CI01000016_08675783_08684401 KCNJ14 coding downstream 67971 8673411 ~ 8684506 (+)
CI01000016_08696516_08734418 MYH14 coding downstream 91076 8696516 ~ 8734660 (+)
CI01000016_08748359_08750572 NA coding downstream 142919 8748359 ~ 8750736 (+)
CI01000016_08752386_08753821 RPL18.L, RPL18.S, RPL18 coding downstream 146946 8752386 ~ 8753821 (+)
G98220 NA non-coding upstream 411 8604598 ~ 8604812 (+)
G98098 NA non-coding upstream 35536 8566829 ~ 8569687 (+)
G98195 NA non-coding upstream 146152 8458828 ~ 8459071 (+)
G98193 NA non-coding upstream 147057 8457949 ~ 8458166 (+)
G98177 NA non-coding upstream 198927 8406065 ~ 8406296 (+)
G98222 NA non-coding downstream 1962 8607402 ~ 8607866 (+)
G98223 NA non-coding downstream 7524 8612964 ~ 8613740 (+)
G98225 NA non-coding downstream 13096 8618536 ~ 8618854 (+)
G98106 NA non-coding downstream 27483 8632923 ~ 8634430 (+)
G98230 NA non-coding downstream 36748 8642188 ~ 8642410 (+)
G97824 NA other upstream 589448 8014363 ~ 8015775 (+)
CI01000016_07784248_07784757 TWIST1, TWIST1.L, TWIST1A, TWIST1B, TWST2, TWIST1.S other upstream 819500 7783987 ~ 7784996 (+)
G96389 NA other upstream 1443933 7160641 ~ 7161290 (+)
CI01000016_05405791_05407797 AICDA other upstream 3197360 5405791 ~ 5407963 (+)
G95792 NA other upstream 3379282 5219880 ~ 5225941 (+)
G98288 NA other downstream 390658 8996098 ~ 9002717 (+)
CI01000016_09796196_09842235 NA other downstream 1190191 9795950 ~ 9842576 (+)
G99041 NA other downstream 1318978 9924418 ~ 9925654 (+)
G99410 NA other downstream 1628960 10234400 ~ 10236851 (+)
G99456 NA other downstream 1688951 10294391 ~ 10298904 (+)

Expression


Co-expression Network