G98315


Basic Information

Item Value
gene id G98315
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 8762713 ~ 8762969 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU111850
GTTTAACAATGCTGTAAAAAATGAAAAACAAATGTATTTGGACACTTTCTGTTTGTCAAATGTTAGTGGAACATGTCTATAGTTAATGTGATGATTTACACCTGTGAAAACTTCACACATTTACGAAAAACACAGAGAAAAAAAAAGTTAGTTCTGAGAAAAGCATAATTTGTTCGCAGAAGTCCCTTGGTTTGAAACTTTGTATCTCGTTCATTAAAATTCAGTTAATTCATTGCATGTCCAAATACTTCTTGGGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU111850 True 257 lncRNA 0.32 1 8762713 8762969

Neighbor

gene id symbol gene type direction distance location
CI01000016_08752386_08753821 RPL18.L, RPL18.S, RPL18 coding upstream 8892 8752386 ~ 8753821 (+)
CI01000016_08748359_08750572 NA coding upstream 11977 8748359 ~ 8750736 (+)
CI01000016_08696516_08734418 MYH14 coding upstream 28053 8696516 ~ 8734660 (+)
CI01000016_08675783_08684401 KCNJ14 coding upstream 78207 8673411 ~ 8684506 (+)
CI01000016_08628196_08630801 NA coding upstream 131335 8628196 ~ 8631378 (+)
CI01000016_08766170_08768621 LAG3 coding downstream 3201 8766170 ~ 8768778 (+)
CI01000016_08817749_08824067 NA coding downstream 54780 8817749 ~ 8824078 (+)
CI01000016_08916022_08916606 NA coding downstream 152059 8915028 ~ 8916667 (+)
CI01000016_09026732_09050431 NA coding downstream 263763 9026732 ~ 9050838 (+)
CI01000016_09138227_09156795 NA coding downstream 374465 9137434 ~ 9157472 (+)
G98307 NA non-coding upstream 73494 8671758 ~ 8689219 (+)
G98294 NA non-coding upstream 106580 8655762 ~ 8656133 (+)
G98231 NA non-coding upstream 119735 8642761 ~ 8642978 (+)
G98230 NA non-coding upstream 120303 8642188 ~ 8642410 (+)
G98106 NA non-coding upstream 128283 8632923 ~ 8634430 (+)
G98320 NA non-coding downstream 15574 8778543 ~ 8778763 (+)
G98321 NA non-coding downstream 17598 8780567 ~ 8780906 (+)
G98256 NA non-coding downstream 20644 8783613 ~ 8800681 (+)
G98317 NA non-coding downstream 52667 8815636 ~ 8816240 (+)
G98318 NA non-coding downstream 53445 8816414 ~ 8816982 (+)
G97824 NA other upstream 746938 8014363 ~ 8015775 (+)
CI01000016_07784248_07784757 TWIST1, TWIST1.L, TWIST1A, TWIST1B, TWST2, TWIST1.S other upstream 976990 7783987 ~ 7784996 (+)
G96389 NA other upstream 1601423 7160641 ~ 7161290 (+)
CI01000016_05405791_05407797 AICDA other upstream 3354850 5405791 ~ 5407963 (+)
G95792 NA other upstream 3536772 5219880 ~ 5225941 (+)
G98288 NA other downstream 233129 8996098 ~ 9002717 (+)
CI01000016_09796196_09842235 NA other downstream 1032662 9795950 ~ 9842576 (+)
G99041 NA other downstream 1161449 9924418 ~ 9925654 (+)
G99410 NA other downstream 1471431 10234400 ~ 10236851 (+)
G99456 NA other downstream 1531422 10294391 ~ 10298904 (+)

Expression


Co-expression Network