G98713


Basic Information

Item Value
gene id G98713
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 8808550 ~ 8808992 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU112333
GCCCTCACCCTTTGTGTGTTAAAGAAGGTCGCTCAAGGAGTTGGGTGAAGCATGGTCAGTCTCATGGTGTTACAGCGGCATCTATGGCTCACCCTCACAGAGATCCGTGATTGAGATAAGACACCAAAAGGCCTGTTTGGGGATGCAGTTAGAGTATTCTCTGAGAAAATCAAGGAAGCCCAAAAGCAGTTGCTACCAAATCAGACCTTAGAAGATTACAGCAGATAGTCCGGACTGCTGAGCAAATCACTGGTACAACCCTCCCCACTCTCCAAGAACAGTACTCATCCAGAGAGAGTAGAAGGGCTGGAAAAATCATTCTGGACGCCTCACACCCAGGCCACTTCCTCTTTTGATGCCTGATTGGCGCTATAGAGCACTGAACACCAGAACGGCCAGGCTTAGGAACAGTTTCTTCCCTCAGGCAATCCATCTCATAACCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU112333 True 443 lncRNA 0.49 1 8808550 8808992

Neighbor

gene id symbol gene type direction distance location
CI01000016_08800360_08805384 NA coding downstream 3166 8798407 ~ 8805384 (-)
CI01000016_08769141_08795202 NA coding downstream 12991 8768822 ~ 8795559 (-)
CI01000016_08741387_08746007 NA coding downstream 62484 8740982 ~ 8746066 (-)
CI01000016_08642218_08643021 NA coding downstream 165529 8641441 ~ 8643021 (-)
CI01000016_08605369_08623062 STK31 coding downstream 185488 8605247 ~ 8623062 (-)
CI01000016_08833925_08836497 NA coding upstream 24498 8833490 ~ 8836497 (-)
CI01000016_08851218_08869647 IFFO1B coding upstream 41880 8850872 ~ 8869647 (-)
CI01000016_08871984_08874796 OPN9 coding upstream 62992 8871984 ~ 8874796 (-)
CI01000016_08881761_08888177 GAPDH coding upstream 72559 8881551 ~ 8888237 (-)
CI01000016_08893013_08893496 NPPCL, ANFC1 coding upstream 83606 8888833 ~ 8894737 (-)
G98711 NA non-coding downstream 29956 8778362 ~ 8778594 (-)
G98710 NA non-coding downstream 43092 8765130 ~ 8765458 (-)
G98660 NA non-coding downstream 49925 8753719 ~ 8758625 (-)
G98630 NA non-coding downstream 70154 8734076 ~ 8738396 (-)
G98714 NA non-coding upstream 1437 8810429 ~ 8811232 (-)
G98708 NA non-coding upstream 5853 8814845 ~ 8815701 (-)
G98709 NA non-coding upstream 7422 8816414 ~ 8816889 (-)
G98715 NA non-coding upstream 62283 8871275 ~ 8871516 (-)
G98672 NA non-coding upstream 106930 8915922 ~ 8916673 (-)
G97341 NA other downstream 2648829 6158986 ~ 6159721 (-)
CI01000016_05412782_05415867 NA other downstream 3390333 5412248 ~ 5415906 (-)
CI01000016_05325805_05330265 COX6B2 other downstream 3477704 5325519 ~ 5332874 (-)
CI01000016_04921091_04922518 NA other downstream 3885146 4918975 ~ 4922518 (-)
CI01000016_03921124_03930996 NA other downstream 4877499 3920055 ~ 3931162 (-)
CI01000016_08926089_08945071 NA other upstream 127797 8925960 ~ 8945229 (-)
G98679 NA other upstream 426004 9234996 ~ 9239929 (-)
G98691 NA other upstream 447110 9256102 ~ 9257611 (-)
CI01000016_09510177_09512196 ID4 other upstream 700630 9509622 ~ 9512428 (-)

Expression


Co-expression Network