G98375


Basic Information

Item Value
gene id G98375
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 9085228 ~ 9098103 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU111914
CCCTGGCATTTGGAATAGGGCCGTGGCTTCTTTATAGACGAGGAGGGGCTTAAACCTGGTGTCATGGGCCCCACATCCAGGCTGGCATGATGTGCTCGGCCATGGCCTCTCCTGGTTGCCTTGGCATTGCCGGCATGCCTCTTCCGTTGCCTTTCAGTCAACAGACGTGTGGCCTCCCGTCTGGCAACATTACCCAGCTGCTCCCGATATTCCCCATATAGCAGGGTTTGCTGGTATCTCAGAGCTTTCCTTTGCGACGCATCGGCAGCCATCGACACGCTCGCACTGAGCCAAAAATAAACACACACAGTCTCACTCCTGTGTTACAGCATATGAAACACATACACTGACCGACTCTTACCCGTTTATTCAGTTACACACACA

Function

NR:

description
unnamed protein product

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU111914 True 384 lncRNA 0.53 2 9085228 9098103

Neighbor

gene id symbol gene type direction distance location
CI01000016_09026732_09050431 NA coding upstream 34390 9026732 ~ 9050838 (+)
CI01000016_08916022_08916606 NA coding upstream 168561 8915028 ~ 8916667 (+)
CI01000016_08817749_08824067 NA coding upstream 261150 8817749 ~ 8824078 (+)
CI01000016_08766170_08768621 LAG3 coding upstream 316450 8766170 ~ 8768778 (+)
CI01000016_08752386_08753821 RPL18.L, RPL18.S, RPL18 coding upstream 331407 8752386 ~ 8753821 (+)
CI01000016_09138227_09156795 NA coding downstream 39331 9137434 ~ 9157472 (+)
CI01000016_09181426_09182326 NA coding downstream 83323 9181426 ~ 9182326 (+)
CI01000016_09183871_09184200 TMEM238 coding downstream 85273 9183376 ~ 9184427 (+)
CI01000016_09228083_09231481 NA coding downstream 129980 9228083 ~ 9231635 (+)
CI01000016_09240403_09243601 NA coding downstream 141642 9239745 ~ 9243601 (+)
G98362 NA non-coding upstream 95767 8989238 ~ 8989461 (+)
G98356 NA non-coding upstream 106688 8978232 ~ 8978540 (+)
G98289 NA non-coding upstream 139773 8943217 ~ 8945455 (+)
G98241 NA non-coding upstream 172445 8881009 ~ 8912783 (+)
G98272 NA non-coding upstream 190434 8889842 ~ 8894794 (+)
G98385 NA non-coding downstream 27616 9125719 ~ 9125931 (+)
G98391 NA non-coding downstream 77096 9175199 ~ 9175960 (+)
G98392 NA non-coding downstream 113247 9211350 ~ 9211766 (+)
G98280 NA non-coding downstream 126346 9224449 ~ 9226908 (+)
G98290 NA non-coding downstream 228271 9326374 ~ 9375553 (+)
G98288 NA other upstream 82511 8996098 ~ 9002717 (+)
G97824 NA other upstream 1069453 8014363 ~ 8015775 (+)
CI01000016_07784248_07784757 TWIST1, TWIST1.L, TWIST1A, TWIST1B, TWST2, TWIST1.S other upstream 1299505 7783987 ~ 7784996 (+)
G96389 NA other upstream 1923938 7160641 ~ 7161290 (+)
CI01000016_05405791_05407797 AICDA other upstream 3677365 5405791 ~ 5407963 (+)
CI01000016_09796196_09842235 NA other downstream 697528 9795950 ~ 9842576 (+)
G99041 NA other downstream 826315 9924418 ~ 9925654 (+)
G99410 NA other downstream 1136297 10234400 ~ 10236851 (+)
G99456 NA other downstream 1196288 10294391 ~ 10298904 (+)
G99940 NA other downstream 2573542 11671645 ~ 11672873 (+)

Expression


Co-expression Network