G98776


Basic Information

Item Value
gene id G98776
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 9101601 ~ 9101813 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU112396
CCCCTTAATCTGCACGTTTTCACCCATGGTGCCATCATTTTGTTTTCACAAGAGAAAACCGTGTACCAGTTCTAAGGCCATGGAAAAAGTTCGAGCAAAGCATGCTAATTGTTCTGTCGTTGGCTGCACAGACGAGCACAGAACACTATTTAGAGTCTCGTTAGCTTGGATGGCCTGCAAGTTGACCCTGGCAAGCTCGATTGCTAAAAAAAG

Function

NR:

description
neurocan core protein

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU112396 True 213 lncRNA 0.46 1 9101601 9101813

Neighbor

gene id symbol gene type direction distance location
CI01000016_09060801_09086358 CLCN1B coding downstream 13402 9060522 ~ 9088199 (-)
CI01000016_08947581_08961131 ZYX coding downstream 140470 8946148 ~ 8961131 (-)
CI01000016_08926089_08945071 NA coding downstream 156530 8925960 ~ 8945229 (-)
CI01000016_08920718_08923668 EMG1 coding downstream 177553 8920465 ~ 8924048 (-)
CI01000016_08906943_08914821 NOP2 coding downstream 186661 8906612 ~ 8914940 (-)
CI01000016_09107780_09122244 CASP2 coding upstream 5596 9107409 ~ 9122290 (-)
CI01000016_09129190_09132103 NA coding upstream 25795 9127608 ~ 9132103 (-)
CI01000016_09164404_09171973 CCDC106A, CCDC106 coding upstream 62591 9164404 ~ 9174758 (-)
CI01000016_09185530_09205841 NA coding upstream 83591 9185404 ~ 9206034 (-)
CI01000016_09212039_09212358 NA coding upstream 110184 9211997 ~ 9213170 (-)
G98694 NA non-coding downstream 43483 9057812 ~ 9058118 (-)
G98658 NA non-coding downstream 175833 8924510 ~ 8925768 (-)
G98672 NA non-coding downstream 184928 8915922 ~ 8916673 (-)
G98715 NA non-coding downstream 230085 8871275 ~ 8871516 (-)
G98709 NA non-coding downstream 284712 8816414 ~ 8816889 (-)
G98778 NA non-coding upstream 1410 9103223 ~ 9103458 (-)
G98675 NA non-coding upstream 3581 9105394 ~ 9107226 (-)
G98666 NA non-coding upstream 54856 9156669 ~ 9158272 (-)
G98783 NA non-coding upstream 73369 9175182 ~ 9175917 (-)
G98683 NA non-coding upstream 132091 9233904 ~ 9234433 (-)
CI01000016_08893013_08893496 NPPCL, ANFC1 other downstream 206864 8888833 ~ 8894737 (-)
G97341 NA other downstream 2941880 6158986 ~ 6159721 (-)
CI01000016_05412782_05415867 NA other downstream 3683384 5412248 ~ 5415906 (-)
CI01000016_05325805_05330265 COX6B2 other downstream 3770755 5325519 ~ 5332874 (-)
G98679 NA other upstream 133183 9234996 ~ 9239929 (-)
G98691 NA other upstream 154289 9256102 ~ 9257611 (-)
CI01000016_09510177_09512196 ID4 other upstream 407809 9509622 ~ 9512428 (-)
G99178 NA other upstream 712548 9814361 ~ 9814955 (-)
G100190 NA other upstream 949355 10051168 ~ 10052389 (-)

Expression


Co-expression Network