G98831


Basic Information

Item Value
gene id G98831
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 9310991 ~ 9311210 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU112465
TACAGTTAAGGATACACCATAACCAGCTCTGAGTAAGGGTACTGAAATAATAATAATAATAAAAAAATTATTAGCAGCTGAATTTGTTTTCAGTGTGATGAGTTTGGCAGAGTTTAAGAAACATTGAACATAGAATAATAGAAACATTGAATTCTCAGAAACTACAGAGCTGTTCCAGATTCAGTATTACATTATCTGACACGATATTGCTGATGGTAAC

Function

NR:

description
transposase-like, partial

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU112465 True 220 lncRNA 0.32 1 9310991 9311210

Neighbor

gene id symbol gene type direction distance location
CI01000016_09251602_09253351 NA coding downstream 57640 9251412 ~ 9253351 (-)
CI01000016_09224593_09226660 NA coding downstream 84331 9224467 ~ 9226660 (-)
CI01000016_09212039_09212358 NA coding downstream 97821 9211997 ~ 9213170 (-)
CI01000016_09185530_09205841 NA coding downstream 104957 9185404 ~ 9206034 (-)
CI01000016_09164404_09171973 CCDC106A, CCDC106 coding downstream 136233 9164404 ~ 9174758 (-)
CI01000016_09376209_09382250 TAPBPL coding upstream 64999 9376209 ~ 9382250 (-)
CI01000016_09384358_09401878 GRHL2A coding upstream 72952 9384162 ~ 9401878 (-)
CI01000016_09410080_09416286 NCALDA, NCALDB, HPCAL1, NCALD.L, NCALD coding upstream 98696 9409906 ~ 9417767 (-)
CI01000016_09475913_09487996 NA coding upstream 163787 9474997 ~ 9488292 (-)
CI01000016_09510177_09512196 ID4 coding upstream 198449 9509622 ~ 9512428 (-)
G98789 NA non-coding downstream 55109 9255635 ~ 9255882 (-)
G98692 NA non-coding downstream 55663 9254951 ~ 9255328 (-)
G98683 NA non-coding downstream 76558 9233904 ~ 9234433 (-)
G98783 NA non-coding downstream 135074 9175182 ~ 9175917 (-)
G98666 NA non-coding downstream 152719 9156669 ~ 9158272 (-)
G98834 NA non-coding upstream 2365 9313575 ~ 9314005 (-)
G98802 NA non-coding upstream 6361 9317571 ~ 9324495 (-)
G98809 NA non-coding upstream 13957 9325167 ~ 9325698 (-)
G98838 NA non-coding upstream 14676 9325886 ~ 9326240 (-)
G98808 NA non-coding upstream 33394 9344604 ~ 9345448 (-)
G98691 NA other downstream 53380 9256102 ~ 9257611 (-)
G98679 NA other downstream 71062 9234996 ~ 9239929 (-)
CI01000016_08926089_08945071 NA other downstream 365762 8925960 ~ 8945229 (-)
CI01000016_08893013_08893496 NPPCL, ANFC1 other downstream 416254 8888833 ~ 8894737 (-)
G97341 NA other downstream 3151270 6158986 ~ 6159721 (-)
G99178 NA other upstream 503151 9814361 ~ 9814955 (-)
G100190 NA other upstream 739958 10051168 ~ 10052389 (-)

Expression


Co-expression Network