G98271



Basic Information


Item Value
gene id G98271
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 9376217 ~ 9378050 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU111805
CTGAATGCTTGATACAAAAACAGCACTGATATCACCAACATGAAGATGATTGTCCAGAAGGCTTTTTCTTGGTTCAGGTTTGTCCACAGTCAGGCTGACCTCACTGTGTGTTTCTAGGGCGGTGTGAGAGACCCTACAGGTGACAACCGTCCCCGGTGGGTGCGTGTCGGGCCGTAGGGTGAGGTGAGAGGAGAGGGAATATGTTCCATCACTGTGCTGCCGATGGCTGGAGAGGGAGGATTCTTTTGTCAAAGAGACCGGCTCTTCTGCAGAGGGCACCTGGAAAAACCAC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU111805 True 292 lncRNA 0.52 2 9376217 9378050

Neighbor


gene id symbol gene type direction distance location
CI01000016_09364728_09366356 VAMP1 coding upstream 9861 9364649 ~ 9366356 (+)
CI01000016_09363759_09363932 NA coding upstream 11844 9363759 ~ 9364373 (+)
CI01000016_09357617_09361063 PSMD4B, PSMD4, PSMD4A coding upstream 15154 9357617 ~ 9361063 (+)
CI01000016_09340494_09349036 PIP5K1A, PIP5K1AB coding upstream 27181 9340494 ~ 9349036 (+)
CI01000016_09317824_09332379 NA coding upstream 43503 9317722 ~ 9332714 (+)
CI01000016_09524279_09527107 NA coding downstream 145567 9523617 ~ 9527207 (+)
CI01000016_09615039_09616082 NA coding downstream 234741 9612791 ~ 9617419 (+)
CI01000016_09663511_09664293 NA coding downstream 285461 9663511 ~ 9664495 (+)
CI01000016_09664848_09674309 CEP192, SEH1L coding downstream 286798 9664848 ~ 9674728 (+)
CI01000016_09686132_09706397 CEP192 coding downstream 308082 9686132 ~ 9706453 (+)
G98290 NA non-coding upstream 664 9326374 ~ 9375553 (+)
G98280 NA non-coding upstream 149309 9224449 ~ 9226908 (+)
G98392 NA non-coding upstream 164451 9211350 ~ 9211766 (+)
G98391 NA non-coding upstream 200257 9175199 ~ 9175960 (+)
G98385 NA non-coding upstream 250286 9125719 ~ 9125931 (+)
G98409 NA non-coding downstream 21905 9399955 ~ 9402046 (+)
G98414 NA non-coding downstream 25817 9403867 ~ 9404218 (+)
G98415 NA non-coding downstream 26317 9404367 ~ 9404679 (+)
G98416 NA non-coding downstream 26968 9405018 ~ 9405471 (+)
G98442 NA non-coding downstream 95125 9473175 ~ 9473571 (+)
G98288 NA other upstream 373500 8996098 ~ 9002717 (+)
G97824 NA other upstream 1360442 8014363 ~ 8015775 (+)
CI01000016_07784248_07784757 TWIST1, TWIST1.L, TWIST1A, TWIST1B, TWST2, TWIST1.S other upstream 1590494 7783987 ~ 7784996 (+)
G96389 NA other upstream 2214927 7160641 ~ 7161290 (+)
CI01000016_05405791_05407797 AICDA other upstream 3968354 5405791 ~ 5407963 (+)
CI01000016_09796196_09842235 NA other downstream 417581 9795950 ~ 9842576 (+)
G99041 NA other downstream 546368 9924418 ~ 9925654 (+)
G99410 NA other downstream 856350 10234400 ~ 10236851 (+)
G99456 NA other downstream 916341 10294391 ~ 10298904 (+)
G99940 NA other downstream 2293595 11671645 ~ 11672873 (+)

Expression



Co-expression Network