G98887


Basic Information

Item Value
gene id G98887
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 9493643 ~ 9493939 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU112524
CTGAAAGGTATATAAAGGTTTTAGAGCACCAGACGATTTATTTAGTCTATTTCAGGGCCTTGTGTATTTCAGCAGGACAATGCAAAACCACATACTGCAGCTATTACAACAGCATGGCTTCGTCGTAGAAGAGTCCGGGTGCTGAATTGGCCTGCCTGCAGTCCAGATCTTTAACCTATAGAGAAAAATACGTCAAAGACGACCACGAACTCTTCAGCAGCTGGAAACATATATCAGGCAAGAATGGGACCAAATTCCAACACCAAAACTCCAGAAACTCATAACCTCGATGCCCAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU112524 True 297 lncRNA 0.44 1 9493643 9493939

Neighbor

gene id symbol gene type direction distance location
CI01000016_09475913_09487996 NA coding downstream 5351 9474997 ~ 9488292 (-)
CI01000016_09410080_09416286 NCALDA, NCALDB, HPCAL1, NCALD.L, NCALD coding downstream 75876 9409906 ~ 9417767 (-)
CI01000016_09384358_09401878 GRHL2A coding downstream 91765 9384162 ~ 9401878 (-)
CI01000016_09376209_09382250 TAPBPL coding downstream 111393 9376209 ~ 9382250 (-)
CI01000016_09251602_09253351 NA coding downstream 240292 9251412 ~ 9253351 (-)
CI01000016_09510177_09512196 ID4 coding upstream 15720 9509622 ~ 9512428 (-)
CI01000016_09638800_09651752 CEP76 coding upstream 144653 9638592 ~ 9651752 (-)
CI01000016_09654611_09661197 NA coding upstream 159563 9653502 ~ 9661197 (-)
CI01000016_09739013_09746676 NA coding upstream 245074 9739013 ~ 9746676 (-)
CI01000016_09959197_09962175 NA coding upstream 463983 9957922 ~ 9963244 (-)
G98885 NA non-coding downstream 3837 9489565 ~ 9489806 (-)
G98878 NA non-coding downstream 13016 9480394 ~ 9480627 (-)
G98853 NA non-coding downstream 96124 9356362 ~ 9397519 (-)
G98808 NA non-coding downstream 148195 9344604 ~ 9345448 (-)
G98898 NA non-coding upstream 19826 9513765 ~ 9513998 (-)
G98901 NA non-coding upstream 24440 9518379 ~ 9518655 (-)
G98906 NA non-coding upstream 29089 9523028 ~ 9523298 (-)
G98914 NA non-coding upstream 40583 9534522 ~ 9534762 (-)
G99078 NA non-coding upstream 47086 9541025 ~ 9541287 (-)
G98691 NA other downstream 236032 9256102 ~ 9257611 (-)
G98679 NA other downstream 253714 9234996 ~ 9239929 (-)
CI01000016_08926089_08945071 NA other downstream 548414 8925960 ~ 8945229 (-)
CI01000016_08893013_08893496 NPPCL, ANFC1 other downstream 598906 8888833 ~ 8894737 (-)
G97341 NA other downstream 3333922 6158986 ~ 6159721 (-)
G99178 NA other upstream 320422 9814361 ~ 9814955 (-)
G100190 NA other upstream 557229 10051168 ~ 10052389 (-)

Expression


Co-expression Network