G99040


Basic Information

Item Value
gene id G99040
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 9864003 ~ 9864223 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU112689
GGTGGAGCCACAGCAAGGAGCATCCGAGGTGGAGCCAGGGTGCCAGAGGACTGAGGCAGAGCCAGTGGGACTAAGGACCAACACGGAGCCAGAGGGAAGGCAGAGCCTGGCAGAGCTGAAGAGGCAGAGAGATGAAGCACAGCTTAAGGCCTGGAAATCCACGGTGCAGGCCGAGCAATGACTGACCAAGACTGAGCCGGAGGGATGAGGGAGCCCGGTGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU112689 True 221 lncRNA 0.62 1 9864003 9864223

Neighbor

gene id symbol gene type direction distance location
CI01000016_09796196_09842235 NA coding upstream 21427 9795950 ~ 9842576 (+)
CI01000016_09788926_09791625 SDC2 coding upstream 72080 9788926 ~ 9791923 (+)
CI01000016_09748780_09759954 MRS2 coding upstream 103620 9748780 ~ 9760383 (+)
CI01000016_09731997_09734823 NA coding upstream 129180 9731997 ~ 9734823 (+)
CI01000016_09686132_09706397 CEP192 coding upstream 157550 9686132 ~ 9706453 (+)
CI01000016_09868120_09886212 NA coding downstream 3853 9868076 ~ 9886233 (+)
CI01000016_09897221_09902690 NA coding downstream 32623 9896846 ~ 9902882 (+)
CI01000016_09934128_09954587 NA coding downstream 69905 9934128 ~ 9955328 (+)
CI01000016_09970010_09999304 NA coding downstream 105692 9969915 ~ 10000721 (+)
CI01000016_10042324_10051398 CTNNB1.L, CTNNB1 coding downstream 177793 10042016 ~ 10052367 (+)
G99034 NA non-coding upstream 7155 9856512 ~ 9856848 (+)
G99024 NA non-coding upstream 77440 9785610 ~ 9786563 (+)
G99023 NA non-coding upstream 90779 9769865 ~ 9773224 (+)
G99022 NA non-coding upstream 94279 9765978 ~ 9769724 (+)
G99013 NA non-coding upstream 115742 9747983 ~ 9748261 (+)
G99056 NA non-coding downstream 35330 9899553 ~ 9900079 (+)
G99062 NA non-coding downstream 56044 9920267 ~ 9920479 (+)
G99063 NA non-coding downstream 56958 9921181 ~ 9940824 (+)
G99281 NA non-coding downstream 204021 10068244 ~ 10068606 (+)
G98288 NA other upstream 861286 8996098 ~ 9002717 (+)
G97824 NA other upstream 1848228 8014363 ~ 8015775 (+)
CI01000016_07784248_07784757 TWIST1, TWIST1.L, TWIST1A, TWIST1B, TWST2, TWIST1.S other upstream 2078280 7783987 ~ 7784996 (+)
G96389 NA other upstream 2702713 7160641 ~ 7161290 (+)
G99041 NA other downstream 60195 9924418 ~ 9925654 (+)
G99410 NA other downstream 370177 10234400 ~ 10236851 (+)
G99456 NA other downstream 430168 10294391 ~ 10298904 (+)
G99940 NA other downstream 1807422 11671645 ~ 11672873 (+)
G100178 NA other downstream 2296418 12160641 ~ 12162845 (+)

Expression


Co-expression Network