G99216


Basic Information

Item Value
gene id G99216
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 9887373 ~ 9887587 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU112889
GCAGAATTTGATCTTGTAATATAACTTAGTAGGCTACATTAAGCGACGTTAAGCTTTTTCTTTATAACGTTTTTCTATGGGAGGAAAACACAATGTGTAATTAAATGAACTGCGTTCATATTCTGGGCTCATCTGCTTTGCTGTATATAGTATGGTTTATTAGTATGATGTTTACGGAGTTCGGTCTTTTAATATCACTGTCTTAGTACATTAAG

Function

NR:

description
unnamed protein product, partial

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU112889 True 215 lncRNA 0.33 1 9887373 9887587

Neighbor

gene id symbol gene type direction distance location
CI01000016_09739013_09746676 NA coding downstream 140697 9739013 ~ 9746676 (-)
CI01000016_09654611_09661197 NA coding downstream 226176 9653502 ~ 9661197 (-)
CI01000016_09638800_09651752 CEP76 coding downstream 235621 9638592 ~ 9651752 (-)
CI01000016_09510177_09512196 ID4 coding downstream 375008 9509622 ~ 9512428 (-)
CI01000016_09475913_09487996 NA coding downstream 399081 9474997 ~ 9488292 (-)
CI01000016_09959197_09962175 NA coding upstream 70335 9957922 ~ 9963244 (-)
CI01000016_10025722_10027148 NA coding upstream 137915 10025502 ~ 10027259 (-)
CI01000016_10089136_10135299 NA coding upstream 201129 10088716 ~ 10135299 (-)
CI01000016_10228314_10299064 ULK4 coding upstream 340727 10228314 ~ 10299064 (-)
CI01000016_10386099_10386648 NA coding upstream 498238 10385825 ~ 10387482 (-)
G99204 NA non-coding downstream 31544 9855622 ~ 9855829 (-)
G99201 NA non-coding downstream 34936 9852206 ~ 9852437 (-)
G99189 NA non-coding downstream 51377 9825890 ~ 9835996 (-)
G99180 NA non-coding downstream 81459 9805316 ~ 9805914 (-)
G99173 NA non-coding downstream 87701 9798952 ~ 9799672 (-)
G99217 NA non-coding upstream 70 9887657 ~ 9888150 (-)
G99225 NA non-coding upstream 30309 9917896 ~ 9918176 (-)
G100209 NA non-coding upstream 116169 10003756 ~ 10003959 (-)
G100213 NA non-coding upstream 128566 10016153 ~ 10016831 (-)
G99178 NA other downstream 72418 9814361 ~ 9814955 (-)
G98691 NA other downstream 629762 9256102 ~ 9257611 (-)
G98679 NA other downstream 647444 9234996 ~ 9239929 (-)
CI01000016_08926089_08945071 NA other downstream 942144 8925960 ~ 8945229 (-)
G100190 NA other upstream 163581 10051168 ~ 10052389 (-)

Expression


Co-expression Network