G99217


Basic Information

Item Value
gene id G99217
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 9887657 ~ 9888150 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU112890
GCAGTTTATTATTGAGTCAACAAGACAAACAATGTGAAATCTACGTTAATTACAATGGTTGATTAACGTTACAATCTTCTACAGGTGTTATTCCGAGTTCTGCATAACGTTACATGCCAAGAATTGCATTCACCTCCAAGTAGCTACTGTTTAAAAACTATATAATATTCTTTGTGGGGTTCATTAATGCTGAAATAATTCGGCAGAACAAATGTTGTAGGCTACCTGCAGAGATTTGCATCCACCTCTTTTCTCAGCATAAATGACTGTTACCTCCTGCGGGACGTAATGGGATGTTCTAAAACATTTAACGTGAAAAGCTTACGTGGCTTAATTTACTAGACATTTATTAACAAACCAAACCTATTAAACACCATACTAATAAAGCATACTATGTAGGCCTACAGAAAAGCAGATGAGCCCATAATATGAACGCAACACGTTTAATTTTCCTCCCATAAAGAAAACGCTTAACTTGGCTTAATGTAAAACAG

Function

NR:

description
unnamed protein product, partial

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU112890 True 494 lncRNA 0.36 1 9887657 9888150

Neighbor

gene id symbol gene type direction distance location
CI01000016_09739013_09746676 NA coding downstream 140981 9739013 ~ 9746676 (-)
CI01000016_09654611_09661197 NA coding downstream 226460 9653502 ~ 9661197 (-)
CI01000016_09638800_09651752 CEP76 coding downstream 235905 9638592 ~ 9651752 (-)
CI01000016_09510177_09512196 ID4 coding downstream 375292 9509622 ~ 9512428 (-)
CI01000016_09475913_09487996 NA coding downstream 399365 9474997 ~ 9488292 (-)
CI01000016_09959197_09962175 NA coding upstream 69772 9957922 ~ 9963244 (-)
CI01000016_10025722_10027148 NA coding upstream 137352 10025502 ~ 10027259 (-)
CI01000016_10089136_10135299 NA coding upstream 200566 10088716 ~ 10135299 (-)
CI01000016_10228314_10299064 ULK4 coding upstream 340164 10228314 ~ 10299064 (-)
CI01000016_10386099_10386648 NA coding upstream 497675 10385825 ~ 10387482 (-)
G99216 NA non-coding downstream 70 9887373 ~ 9887587 (-)
G99204 NA non-coding downstream 31828 9855622 ~ 9855829 (-)
G99201 NA non-coding downstream 35220 9852206 ~ 9852437 (-)
G99189 NA non-coding downstream 51661 9825890 ~ 9835996 (-)
G99180 NA non-coding downstream 81743 9805316 ~ 9805914 (-)
G99225 NA non-coding upstream 29746 9917896 ~ 9918176 (-)
G100209 NA non-coding upstream 115606 10003756 ~ 10003959 (-)
G100213 NA non-coding upstream 128003 10016153 ~ 10016831 (-)
G100214 NA non-coding upstream 128806 10016956 ~ 10017211 (-)
G99178 NA other downstream 72702 9814361 ~ 9814955 (-)
G98691 NA other downstream 630046 9256102 ~ 9257611 (-)
G98679 NA other downstream 647728 9234996 ~ 9239929 (-)
CI01000016_08926089_08945071 NA other downstream 942428 8925960 ~ 8945229 (-)
G100190 NA other upstream 163018 10051168 ~ 10052389 (-)

Expression


Co-expression Network