G99062


Basic Information

Item Value
gene id G99062
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 9920267 ~ 9920479 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU112715
CCGGCACCCCAGCAAACCACTTTTCCAGTCATTCGTTCTGCTTAGGAGCAGCAACCACAGCTGCCCAAAAAGGCCTTTCCCAGAATCAGATTCAAACACTTGGTCGCTGGTCATCAGAAGCTTTTTAAGAACTACACCCGATCAAATCGCTTCCACATTAAAGAAGCCCAACGAACCCTTATCAGCTAAGTTTTCAGCTCCAGCTTGTTCTCT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU112715 True 213 lncRNA 0.47 1 9920267 9920479

Neighbor

gene id symbol gene type direction distance location
CI01000016_09897221_09902690 NA coding upstream 17385 9896846 ~ 9902882 (+)
CI01000016_09868120_09886212 NA coding upstream 34034 9868076 ~ 9886233 (+)
CI01000016_09796196_09842235 NA coding upstream 77691 9795950 ~ 9842576 (+)
CI01000016_09788926_09791625 SDC2 coding upstream 128344 9788926 ~ 9791923 (+)
CI01000016_09748780_09759954 MRS2 coding upstream 159884 9748780 ~ 9760383 (+)
CI01000016_09934128_09954587 NA coding downstream 13649 9934128 ~ 9955328 (+)
CI01000016_09970010_09999304 NA coding downstream 49436 9969915 ~ 10000721 (+)
CI01000016_10042324_10051398 CTNNB1.L, CTNNB1 coding downstream 121537 10042016 ~ 10052367 (+)
CI01000016_10333877_10334229 NA coding downstream 413398 10333877 ~ 10334346 (+)
CI01000016_10339126_10370881 TRAK1 coding downstream 414779 10335258 ~ 10372651 (+)
G99056 NA non-coding upstream 20188 9899553 ~ 9900079 (+)
G99040 NA non-coding upstream 56044 9864003 ~ 9864223 (+)
G99034 NA non-coding upstream 63419 9856512 ~ 9856848 (+)
G99024 NA non-coding upstream 133704 9785610 ~ 9786563 (+)
G99023 NA non-coding upstream 147043 9769865 ~ 9773224 (+)
G99063 NA non-coding downstream 702 9921181 ~ 9940824 (+)
G99281 NA non-coding downstream 147765 10068244 ~ 10068606 (+)
G99283 NA non-coding downstream 149426 10069905 ~ 10070116 (+)
G99284 NA non-coding downstream 149640 10070119 ~ 10070348 (+)
G98288 NA other upstream 917550 8996098 ~ 9002717 (+)
G97824 NA other upstream 1904492 8014363 ~ 8015775 (+)
CI01000016_07784248_07784757 TWIST1, TWIST1.L, TWIST1A, TWIST1B, TWST2, TWIST1.S other upstream 2134544 7783987 ~ 7784996 (+)
G96389 NA other upstream 2758977 7160641 ~ 7161290 (+)
G99041 NA other downstream 3939 9924418 ~ 9925654 (+)
G99410 NA other downstream 313921 10234400 ~ 10236851 (+)
G99456 NA other downstream 373912 10294391 ~ 10298904 (+)
G99940 NA other downstream 1751166 11671645 ~ 11672873 (+)
G100178 NA other downstream 2240162 12160641 ~ 12162845 (+)

Expression


Co-expression Network