G100413



Basic Information


Item Value
gene id G100413
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 10652743 ~ 10715678 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU114256
GTTCTACTGGGAAACCTTGGGTCCTTCCATCCATGTGGATGTTACTTTGACACGTACCACCTACCTAAGCATTGTTGCAGACCATGTACACCCTTTCATGTAAACGGTATTCCCTGGTGGCTGTGGCCTCTTTCAGCAGGATAATGTGCCCTGCCACAAAGCAAAAATGGTTCAGGAATGGTTTGAGGAGCACAACAACGAGTTTGAGGTGTTGACTTGACCTCTAAATTCCCCAGATCTCCATCCAATCGAGCATCTGTGGGATGTGCTGAACAAACAAGTCCAATCCATGGAGGCCCCACCTCG

Function


NR:

description
PREDICTED: coiled-coil and C2 domain-containing protein 1A

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU114256 True 306 lncRNA 0.49 2 10652743 10715678

Neighbor


gene id symbol gene type direction distance location
CI01000016_10637748_10650217 TCAIM coding downstream 2526 10637639 ~ 10650217 (-)
CI01000016_10600154_10633808 TRIM71 coding downstream 18935 10599202 ~ 10633808 (-)
CI01000016_10571262_10572444 NA coding downstream 78875 10570705 ~ 10573868 (-)
CI01000016_10443526_10488009 NA coding downstream 164557 10442845 ~ 10488186 (-)
CI01000016_10386099_10386648 NA coding downstream 265261 10385825 ~ 10387482 (-)
CI01000016_10740961_10745890 ABHD5A, ABHD5 coding upstream 24268 10739946 ~ 10745890 (-)
CI01000016_10799559_10842613 SNRK, SNRKA coding upstream 83507 10799185 ~ 10843409 (-)
CI01000016_10897488_10911334 NA coding upstream 180508 10896186 ~ 10911334 (-)
CI01000016_10931329_10940939 ENTPD3 coding upstream 215134 10930812 ~ 10941053 (-)
CI01000016_10970952_10971167 NA coding upstream 254829 10970507 ~ 10971167 (-)
G100351 NA non-coding downstream 101319 10529416 ~ 10551424 (-)
G100379 NA non-coding downstream 173891 10476982 ~ 10478852 (-)
G100378 NA non-coding downstream 176608 10475251 ~ 10476135 (-)
G100324 NA non-coding downstream 300613 10333883 ~ 10352130 (-)
G100302 NA non-coding downstream 365252 10287251 ~ 10287491 (-)
G100350 NA non-coding upstream 20870 10736548 ~ 10736879 (-)
G100346 NA non-coding upstream 21275 10736953 ~ 10737372 (-)
G100358 NA non-coding upstream 31171 10746849 ~ 10749597 (-)
G100347 NA non-coding upstream 37936 10753614 ~ 10763884 (-)
G100469 NA non-coding upstream 177199 10892877 ~ 10893117 (-)
G100190 NA other downstream 600354 10051168 ~ 10052389 (-)
G99178 NA other downstream 837788 9814361 ~ 9814955 (-)
CI01000016_09510177_09512196 ID4 other downstream 1140315 9509622 ~ 9512428 (-)
G98691 NA other downstream 1395132 9256102 ~ 9257611 (-)
G98679 NA other downstream 1412814 9234996 ~ 9239929 (-)

Expression



Co-expression Network