G99635


Basic Information

Item Value
gene id G99635
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 10893358 ~ 10893733 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU113361
TGTAAAAGAAGATTTTGGTTACACTTTATTTTACAGTGCCGTAGTTACATTAAGTACTGAGTGCTATTAATTAACTACATGTACTTACTATAGAGTTACAGTTAGGGTTAGGGTTTGGTTTAGGGTTAGTTACTTGTAATTATGCATAATTTACTGTTATTACTTTAGTAAGTACCAGTGGCGAGCGGTGACTTTTTTTAACGGGGTATGCTGGGTGGGGCGTCATGTAAAAAAATGTGGCCGATGCAGTTTGAATGGGTTTATAGCTAATATGCGAGACACTCGTGTTCTCAGTGTTAGTTTATTCATTGCTCATGACAAATAGCAACAAAGCGAAAAGTATTTCTAATATGTTGGACCTTTTATTGAGAGTAGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU113361 True 376 lncRNA 0.36 1 10893358 10893733

Neighbor

gene id symbol gene type direction distance location
CI01000016_10881609_10887779 NA coding upstream 5461 10881461 ~ 10887897 (+)
CI01000016_10865834_10867561 POMGNT2 coding upstream 25710 10865349 ~ 10867648 (+)
CI01000016_10760640_10783664 ANO10A, ANO10 coding upstream 109499 10760640 ~ 10783859 (+)
CI01000016_10756608_10758149 NA coding upstream 135157 10754393 ~ 10758201 (+)
CI01000016_10748252_10749230 NA coding upstream 144015 10748252 ~ 10749343 (+)
CI01000016_10967556_10968779 NA coding downstream 73823 10967556 ~ 10969416 (+)
CI01000016_11277549_11278592 NA coding downstream 382822 11276555 ~ 11278855 (+)
CI01000016_11298638_11300240 NA coding downstream 403937 11297670 ~ 11300506 (+)
CI01000016_11311430_11313782 NA coding downstream 417148 11310881 ~ 11314080 (+)
CI01000016_11330944_11334103 NA coding downstream 436480 11330213 ~ 11334466 (+)
G99636 NA non-coding upstream 2097 10890758 ~ 10891261 (+)
G99607 NA non-coding upstream 42078 10851057 ~ 10851280 (+)
G99557 NA non-coding upstream 56730 10832270 ~ 10836628 (+)
G99552 NA non-coding upstream 156479 10736587 ~ 10736879 (+)
G99554 NA non-coding upstream 156862 10736196 ~ 10736496 (+)
G99679 NA non-coding downstream 52901 10946634 ~ 10946842 (+)
G99680 NA non-coding downstream 53195 10946928 ~ 10947157 (+)
G99681 NA non-coding downstream 53537 10947270 ~ 10947489 (+)
G99691 NA non-coding downstream 63495 10957228 ~ 10957449 (+)
G99694 NA non-coding downstream 69727 10963460 ~ 10963697 (+)
G99456 NA other upstream 594454 10294391 ~ 10298904 (+)
G99410 NA other upstream 656507 10234400 ~ 10236851 (+)
G99041 NA other upstream 967704 9924418 ~ 9925654 (+)
CI01000016_09796196_09842235 NA other upstream 1096418 9795950 ~ 9842576 (+)
G98288 NA other upstream 1890641 8996098 ~ 9002717 (+)
G99940 NA other downstream 777912 11671645 ~ 11672873 (+)
G100178 NA other downstream 1266908 12160641 ~ 12162845 (+)

Expression


Co-expression Network