G99709



Basic Information


Item Value
gene id G99709
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 10981360 ~ 10981583 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU113438
ATATCTCCTGATTTTGTTCTGACAGCTGGGGGACTAAATGGCTCAAAAACTGCCTTCTCTTTCTGCGTGGAACAACACTCGACCTTCATGAAGATCTAATGTTTGCTATTGTCAACTGAAGTATCAATCCTCATCAGAGATAAATAAACATGCGAATATGATATGGACTCAATGTATGCTTAAGTAACTTTATTTGGTAACATTATTATTGCTAACTATATTAT

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU113438 True 224 lncRNA 0.35 1 10981360 10981583

Neighbor


gene id symbol gene type direction distance location
CI01000016_10967556_10968779 NA coding upstream 12045 10967556 ~ 10969416 (+)
CI01000016_10881609_10887779 NA coding upstream 93463 10881461 ~ 10887897 (+)
CI01000016_10865834_10867561 POMGNT2 coding upstream 113712 10865349 ~ 10867648 (+)
CI01000016_10760640_10783664 ANO10A, ANO10 coding upstream 197501 10760640 ~ 10783859 (+)
CI01000016_10756608_10758149 NA coding upstream 223159 10754393 ~ 10758201 (+)
CI01000016_11277549_11278592 NA coding downstream 294972 11276555 ~ 11278855 (+)
CI01000016_11298638_11300240 NA coding downstream 316087 11297670 ~ 11300506 (+)
CI01000016_11311430_11313782 NA coding downstream 329298 11310881 ~ 11314080 (+)
CI01000016_11330944_11334103 NA coding downstream 348630 11330213 ~ 11334466 (+)
CI01000016_11344848_11345696 NA coding downstream 362869 11344452 ~ 11345869 (+)
G99702 NA non-coding upstream 11095 10970026 ~ 10970265 (+)
G99698 NA non-coding upstream 14150 10966941 ~ 10967210 (+)
G99697 NA non-coding upstream 14894 10966157 ~ 10966466 (+)
G99694 NA non-coding upstream 17663 10963460 ~ 10963697 (+)
G99711 NA non-coding downstream 6782 10988365 ~ 10989880 (+)
G99738 NA non-coding downstream 71611 11053194 ~ 11056576 (+)
G99761 NA non-coding downstream 107516 11089099 ~ 11091748 (+)
G99779 NA non-coding downstream 168855 11150438 ~ 11150744 (+)
G99780 NA non-coding downstream 169270 11150853 ~ 11151160 (+)
G99456 NA other upstream 682456 10294391 ~ 10298904 (+)
G99410 NA other upstream 744509 10234400 ~ 10236851 (+)
G99041 NA other upstream 1055706 9924418 ~ 9925654 (+)
CI01000016_09796196_09842235 NA other upstream 1184420 9795950 ~ 9842576 (+)
G98288 NA other upstream 1978643 8996098 ~ 9002717 (+)
G99940 NA other downstream 690062 11671645 ~ 11672873 (+)
G100178 NA other downstream 1179058 12160641 ~ 12162845 (+)

Expression



Co-expression Network